User:Jared Koelling

From OpenWetWare

Jump to: navigation, search

http://openwetware.org/wiki/840:153g/2008



Part-only sequence for BBa_J45120(1292 bp)

tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagtcacacaggaaagtactagatggaagttgttgaagttc ttcacatgaatggaggaaatggagacagtagctatgcaaacaattctttggttcagcaaaaggtgattctcatgacaaagccaataactgagcaagccat gattgatctctacagcagcctctttccagaaaccttatgcattgcagatttgggttgttctttgggagctaacactttcttggtggtctcacagcttgtt aaaatagtagaaaaagaacgaaaaaagcatggttttaagtctccagagttttattttcacttcaatgatcttcctggcaatgattttaatacactttttc agtcactgggggcatttcaagaagatttgagaaagcatataggggaaagctttggtccatgttttttcagtggagtgcctggttcattttatactagact tttcccttccaaaagtttacattttgtttactcctcctacagtctcatgtggctatctcaggtgcctaatgggattgaaaataacaagggaaacatttac atggcaagaacaagccctctaagtgttattaaagcatactacaagcaatatgaaatagatttttcaaattttctcaagtaccgttcagaggaattgatga aaggtggaaagatggtgttaacactcctaggtagagaaagtgaggatcctactagcaaagaatgctgttacatttgggagcttctagccatggccctcaa taagttggttgaagagggattgataaaagaagagaaagtagatgcattcaatattcctcaatacacaccatcaccagcagaagtaaagtacatagttgag aaggaaggatcattcaccattaatcgcttggaaacatcaagagttcattggaatgcttctaataatgagaagaatggtggttacaatgtgtcaaggtgca tgagagctgtggctgagcctttgcttgtcagccactttgacaaggaattgatggatttagtgttccacaagtacgaagagattgtttctgattgcatgtc caaagagaatactgagtttataaatgtcatcatctccttgaccaaaataaattaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaaga ctgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata

Wintergreen – forward and reverse primer #1

Forward Primer Sequence: ACTACTAGAGTCACACAGGAAAGTA


Primer Start Position: 53 Primer Length: 25 Primer TM: 54.2 ºC Primer Self Any: 6.0 Primer GC %: 40.0 % Primer Self End: 2.0 Primer End Stability: 4.30 Primer Penalty: 16.75



Reverse Primer Sequence: TCTAGTAGAGAGCGTTCACCGACAA

Primer Start Position: 1250 Primer Length: 25 Primer TM: 58.6 ºC Primer Self Any: 7.0 Primer GC %: 48.0 % Primer Self End: 2.0 Primer End Stability: 5.19 Primer Penalty: 4.39


Forward primer 1 will have restriction site Xba1 added (TCTAGA)with 4 random nucleotides added for the sequence of AACATCTAGA Reverse primer 1 will have restriction site Spe1 added (ACTAGT) with 4 random nucleotides added for the sequence of TAATACTAGT

For a total forward primer 1 of AACATCTAGAACTACTAGAGTCACACAGGAAAGTA For a total reverse primer 1 of TAATACTAGTTCTAGTAGAGAGCGTTCACCGACAA


tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagtcacacaggaaagtactagatggaagttgttgaagttc ttcacatgaatggaggaaatggagacagtagctatgcaaacaattctttggttcagcaaaaggtgattctcatgacaaagccaataactgagcaagccat gattgatctctacagcagcctctttccagaaaccttatgcattgcagatttgggttgttctttgggagctaacactttcttggtggtctcacagcttgtt aaaatagtagaaaaagaacgaaaaaagcatggttttaagtctccagagttttattttcacttcaatgatcttcctggcaatgattttaatacactttttc agtcactgggggcatttcaagaagatttgagaaagcatataggggaaagctttggtccatgttttttcagtggagtgcctggttcattttatactagact tttcccttccaaaagtttacattttgtttactcctcctacagtctcatgtggctatctcaggtgcctaatgggattgaaaataacaagggaaacatttac atggcaagaacaagccctctaagtgttattaaagcatactacaagcaatatgaaatagatttttcaaattttctcaagtaccgttcagaggaattgatga aaggtggaaagatggtgttaacactcctaggtagagaaagtgaggatcctactagcaaagaatgctgttacatttgggagcttctagccatggccctcaa taagttggttgaagagggattgataaaagaagagaaagtagatgcattcaatattcctcaatacacaccatcaccagcagaagtaaagtacatagttgag aaggaaggatcattcaccattaatcgcttggaaacatcaagagttcattggaatgcttctaataatgagaagaatggtggttacaatgtgtcaaggtgca tgagagctgtggctgagcctttgcttgtcagccactttgacaaggaattgatggatttagtgttccacaagtacgaagagattgtttctgattgcatgtc caaagagaatactgagtttataaatgtcatcatctccttgaccaaaataaattaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaaga ctgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata

Wintergreen -- forward and reverse primer #2 Forward Primer Sequence: TGAGCACTACTAGAGTCACACAGG Primer Start Position: 48 Primer Length: 24 Primer TM: 57.3 ºC Primer Self Any: 7.0 Primer GC %: 50.0 % Primer Self End: 1.0 Primer End Stability: 6.01 Primer Penalty: 2.69


Reverse Primer Sequence: AGTAGAGAGCGTTCACCGACAAAC Primer Start Position: 1247 Primer Length: 24 Primer TM: 58.5 ºC Primer Self Any: 4.0 Primer GC %: 50.0 % Primer Self End: 2.0 Primer End Stability: 4.89 Primer Penalty: 1.53


Forward primer 2 will have restriction site Xba1 added (TCTAGA) with 4 random nucleotides added for the sequence of TAATTCTAGA Reverse primer 2 will have restriction site Pst1 added (CTGCAG) with 4 random nucleotides added for the sequence of TAATCTGCAG

For a total forward primer 2 of TAATTCTAGATGAGCACTACTAGAGTCACACAGG For a total reverse primer 2 of TAATCTGCAGAGTAGAGAGCGTTCACCGACAAAC

Personal tools