User:Ines Sofia Silva Vieira/Notebook/Bio Molec - caderno/2010/03/02

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Next entry

Exercicio TP1

  • Considere a seguinte representação de uma molécula biológica.

TTGACACTACCGAGGTGTACTATTTTTACCCGAGTCGCTAATTTTTGCCGCAAGGTGCTAAGCCGCGAGG AAAGCGAGGCTGAACAGGCAGTCGCCCGTCCACAGGTGACGGTGATCCCGCGTGAGCAGCATGCTATTTC CCGCAAAGATATCAGTGAAAATGCCCTGAAGGTAATGTACAGGCTCAATAAAGCGGGATACGAAGCCTGG


Lembre-se que qualquer representações tem subjacente um conjunto de convenções.

Que moléculas se podem representar desta forma e que convenções estarão implícitas nos diferentes casos?


É um código genético representado por quatro letras diferentes em repetição que representam quatro nucleótidos: Adenina(A), Guanina(G), Citosina(C) e Timina(T). É uma cadeia antiparalela e complementar com o sentido 5' ->3'. Provavelmente a molécula corresponde a DNA uma vez que apresenta o nucleótido Timina e não Uracilo. Contudo, também pode ser RNA(mensageiro, de transferência ou ribossómico) desde que para isso ocorra uma alteração da base nucleotidica T(timina) para U(uracilo). A dupla cadeia de DNA é feita por ligações de hidrogénio.As bases azotadas A emparelham com as T ou U(RNA)-2 ligações de Hidorgénio e as C com as G - 3 ligações H. Os nucleótidos de DNA são compostos por um grupo fosfato, uma base azotada e uma desoxirribose enquanto que o RNA possui uma ribose em vez de desoxirribose, como já foi também referido a base azotada neste caso é uracilo e não timina.

Supondo que se trata de DNA, indique uma forma de apresentação alternativa que represente melhor a sua estrutura real.


Sentido: 5' -> 3', Cadeia dupla complementar e anti paralela com uma ponte de hidrogénio entre as base AT e com duas pontes de H entre C e G. Uma forma de apresentação pode então ser: 5' TTGACACTACCGA... 3' 3' AACTGTGATGGCT... 5'

Poderá esta sequência conter um gene? Justifique a sua resposta.


Antes de mais para esta sequência corresponder a um gene (e consequentemente codificar uma proteína)tem de ser um transcrito de RNA obtido a partir desta molecula. Esta sequência para conter um gene precisa de ter algumas características tais como:

1)um codão de iniciação AUG(MET) - foram encontrados 3 no sentido 5' -> 3', no sentido contrário encontramos dois ATG

2) codão STOP (UAA, UAG e UGG) - encontramos diversos em ambos os sentidos! - CGG, TAG, TGA

Para a sequência conter um ou mais genes, os nucleótidos têm de estar entre estes codões de iniciação e STOP e o quadro de leitura tem de codificar um número de aminoácidos que permita formar uma proteína. Se partirmos do pressuposto de que a sequência não se encontra completa, podemos afirmar que mesmo com um quadro de leitura aberto(sem codões iniciação e STOP) esta pode corresponder a uma porção de um gene que codifica uma proteína.


Indique o resultado da transcrição desta sequência.

A transcrição desta sequência(DNA(nosso DNA -cadeia codificante)-->mRNA) e convencionando que se encontra no sentido 5'->3' é a seguinte: 5' UUGACACUACCGAGGUGUACUAUUUUUACCCGAGUCGCUAAUUUUUGCCGCAAGGUGCUAAGCCGCGAGG AAAGCGAGGCUGAACAGGCAGUCGCCCGUCCACAGGUGACGGUGAUCCCGCGUGAGCAGCAUGCUAUUUC CCGCAAAGAUAUCAGUGAAAAUGCCCUGAAGGUAAUGUACAGGCUCAAUAAAGCGGGAUACGAAGCCUGG 3'

É possível prever que proteína se encontra codificada numa sequência nucleotídica? Como? Sim é possível prever pois pelos codões(tripletos) de RNA podemos ver a que aminoácidos corresponde nos 6 quadros de leitura possíveis e por análise destes vemos se existe alguma proteína com a respectiva composição.


A sequência apresentada codifica alguma proteína?

       5'3' Frame 1

L T L P R C T I F T R V A N F C R K V L S R E E S E A E Q A V A R P Q V T V I P R E Q H A I S R K D I S E N A L K V Met Y R L N K A G Y E A W 5'3' Frame 2 Stop H Y R G V L F L P E S L I F A A R C Stop A A R K A R L N R Q S P V H R Stop R Stop S R V S S Met L F P A K I S V K Met P Stop R Stop C T G S I K R D T K P 5'3' Frame 3 D T T E V Y Y F Y P S R Stop F L P Q G A K P R G K R G Stop T G S R P S T G D G D P A Stop A A C Y F P Q R Y Q Stop K C P E G N V Q A Q Stop S G I R S L 3'5' Frame 1 P G F V S R F I E P V H Y L Q G I F T D I F A G N S Met L L T R D H R H L W T G D C L F S L A F L A A Stop H L A A K I S D S G K N S T P R Stop C Q 3'5' Frame 2 Q A S Y P A L L S L Y I T F R A F S L I S L R E I A C C S R G I T V T C G R A T A C S A S L S S R L S T L R Q K L A T R V K I V H L G S V 3'5' Frame 3 R L R I P L Y Stop A C T L P S G H F H Stop Y L C G K Stop H A A H A G S P S P V D G R L P V Q P R F P R G L A P C G K N Stop R L G Stop K Stop Y T S V V S

A Frame 1 de 5'->3' e a Frame 2 de 3' ->5' são sequências que não está interrompida por codões STOP sendo então sequencias codificantes possiveis de uma proteína. A frame 1 de 3'->5' tem uma particularidade uma vez que corresponde a uma ORF-origem de replicação.


Que diferenças encontra se em vez de aplicar o código genético standard aplicar a variante bacteriana?


O código genético da variante bacteriana apresenta algumas diferenças. A variante bacteriana é uma variante onde o código é ambiguo, isto é, um único tripleto não é especifico, pode codificar em diferentes ocasiões diferentes aminoácidos incluindo um codão stop. O codão de inciação não é restritamente o AUG pode ser também o GUG e UUG. Desta forma, conseguimos mais sequências peptidicas do que com o código standard.


Como poderia saber de que organismo provém esta sequência? Recorreria ao BLAST para comparar esta sequência com as que se encontram na base de dados do NCBI e assim tirar por analogia conclusões quanto ao organismo em questão.



Personal tools