User:Filipa Ribeiro C. Lucas/Notebook/Filipa Lucas/2010/03/16

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

Questões

O que é necessário para fazer uma reacção de sequenciação?

Através do método de sequenciação de DNA de Sanger, que determina a ordem dos nucleotideos que constituem uma amostra, uma nova cadeia de DNA é sintetizada a partir do fragmento de DNA a ser sequenciado (template). As cadeias sintetizadas são marcadas radioactivamente numa extremidade e diferem entre si por um nucleotídeo. Deste modo, para sequencializar um fragmento de DNA é necessário: -DNA template; -DNA polimerase; -dNTP (desoxirribonucleotido trifosfato) que ao ligarem-se, na direcção 5'-3', vão perdendo dois fosfatos e H20; A estrutura quimica de dNTP são a base deste método, os quais se ligam por ligações fosfodiester. - primer com cerca de 20 nucleotídeos para que se inicie a reacção e que define qual a cadeia a ser usada como molde.


Que cadeia é sequenciada?

A cadeia que contém o primer (que permite a polimerização de uma cadeia nova na direcção 5'- 3' ), o qual hibrida com essa cadeia. Posteriormente, são adicionados nucleotideos ao primer (iguais a cadeia complementar).


Porque se diz que a sequenciação pelo método Sanger é uma sequenciação por terminação?

Os ddNTPs (analogos dos dNTP) são conhecidos como temindores quando são incorporados, através da DNA polimerase, no fragmento de DNA a ser sequenciado. Estes análogos não apresentam a extremidade 3'OH, não permitindo que o próximo dNTP forme a ligação seguinte, por isso, bloqueará o processo.


Porque motivo a sequenciação não termina no primeiro nucleótido de cada tipo?

Devido a proporção relativa entre dNTPs e ddNTPs. A quantidade de ddNTPs é muito menor.


Considere o seguinte electroferograma de uma reacção de sequenciação de um DNA purificado. Que problemas consegue observar e porque sucedem?

A electroforese, separação de partículas carregadas por aplicação de um campo eléctrico, é um processo complementar à sequenciação. O tamanho do DNA é proporcional à intensidade do sinal. No inicio da sequenciação, os picos são mais altos, reflectindo a eficiência da mesma. Porém, a medida que são incorporados aleatoriamente nucleotídeos, a sequenciação torna-se menos eficiente, são produzidas moleculas mais peqenas. Por isso, no final da sequenciação os picos perdem definição horizontal e ficam mais largos (são visíveis platos), ou seja, a fusão horizontal reflecte as caractrísticas físicas da electroforese, que começa a falhar.


O segmento de DNA estudado nesta experiência tem 5 Kpb. Tendo em conta que apenas consegue determinar a sequência de 600-1000 nucleótidos em cada reacção de sequenciação, como dever proceder para analisar o fragmento completo?

Realizar várias reacções independentes através do uso de vários primers, tendo sempre em atenção a sequenciação anterior.


Na imagem seguinte está representada o resultado de uma sequênciação de uma região genómica variável (polimórfica) de 2 indivíduos distintos. Qual o genótipo de cada indivíduo?

Variantes heterozigoticos (devido aos picos sobrepostos). Genotipagem relacionada com o problema de hemacromatose (ferro).

Indivíduo 1: TCGTGTTCTATGATCATGAGAGTCGCCG Indivíduo 2: TCGTGTTCTATGAT(C/G)ATGAGAGTCGCCG


Suponha que queria sequenciar o gene e o mRNA da beta-globina. Como deveria proceder? Considere os resultados da sequenciação discutida no Caso de Estudo 1.

Poderia utilizar vários primers ou um primer de cada lado para gerar cadeias sobrepostas.

Personal tools