User:Carly Laroche/Notebook/Biology 210 at AU
3/23/16 Zebrafish Lab
Purpose: To determine the effects of Amoxicillin and Metaprolol on the development of zebrafish embryos.
Materials and Methods:
On day 1, eight wells were filled with Deer Park water, eight wells were filled with 140 mg/ mL of crushed and dissolved Amoxicillin, and eight wells were filled with 50 mg/mL crushed and dissolved metoprolol. Then, one zebrafish embryo between 18 and 36 hours post-fertilization was placed into each well. Following day one, observations were made on every week day regarding the developmental stage, survival, motility, yolk sac size, swim bladder development, mouth, and heart rate of each zebrafish. To observe movement, the container was flicked to induce a startle response and movement was recorded. Every weekday, the correct liquid ( water, dissolved amoxicillin, dissolved metoprolol) was added to each well so that the wells never dried out. Following day five, all fish were fed 15 mL of shrimp brine. After day 7, two drops of paramecium were added to each well whenever the water was changed. On days 7 and 14, several zebrafish from each experimental group and the control group were fixed. Using a dropper, zebrafish were extracted from wells and placed in a vial with tricaine solution. Paraformaldehyde was added and the fixed samples were observed under a microscope. The length of fixed fish was recorded.
Discussion and Conclusions:
The amoxicillin treated fish had the highest survival rate with two fish surviving the full 14 days, whereas all of the other fish died before that time. In comparison to the control, Amoxicillin zebrafish were highly motile and fast and had an enlarged and circular shaped swim bladder. As the swim bladder is similar to the tetrapod lung, this indicates that fish with a larger swim bladder would be able to breathe more rapidly (Winata). Additionally, when comparing these fish to the control, the control was slightly larger in length, as is seen in the fixed measurements (3,500 µm for control and 3,125 µm for the amoxicillin). Additionally, these fish were more straight in comparison to the controls with curved bodies. Although these fish did have some developmental differences, they were a hearty group that was able to survive for longer than the control. It could be inferred that the antibiotics helped fend off any disease in the fish. These results are consistent with previous findings that amoxicillin is not acutely toxic to fish but can cause some developmental disturbances.
The Metaprolol treated fish died at about the same rate as the controls. Their coloration was slightly darker and the fish were smaller than the control fish. Deformities like small fins and curvature were present in the metprolol fish. Additionally, there was little to no movement in the fish when the wells were flicked. From these results, it is clear that the metaprolol had adverse effects on the development of the fish. Because of this information, it can be inferred that beta-blockers impact the development of embryos and cause them to slow down. Because beta-blockers are known to slow heart rate, it is probable that all of the symptoms exhibited by these fish (ie. slower motility) are associated with the slowed heart rate.
These results show that introduction of metaprolol and amoxicillin to an environment can impact the development of embryos in multiple ways. Introducing metaprolol to waterways is not safe for fish embryos because of the high mortality rates and slowed motility. However, exposure to amoxicillin does not cause largely detrimental impacts and is likely safe for embryos to be used as an antibiotic in aquaculture. In fact, the fish seem stronger than the controls.
CKL
3/16/16 Vertebrate Analysis
Purpose: To find out what vertebrates exist in Transect 3 and create a food web of all the organisms present in the transect.
Materials and Methods:
Although no vertebrates were observed directly, we considered what vertebrates may thrive in Transect 3. Then, a food web was created using many of the organisms observed throughout the semester.
Discussion and Conclusions:
Five possible vertebrates that exist in transect 3 include the Black Squirrel (Phylum: Chordata, Class: Mammalia, Order: Rodentia, Family: Sciuridae, Genus: Sciurus, Species: S. carolinesis) American Robin (Phylum: Chordata, Class: Aves, Order:Passeriformes, Family: Turdidae, Genus: Turdus, Species: T. migratorius), Red-headed Woodpecker (Phylum: Chordata, Class: Aves, Order: Piciformes, Family: Picidae, Genus: Melanerpes, Species: M. erythrocephalus), Eastern Garter snake (Phylum: Chordata, Class: Reptilia, Order: Squamata, Family: Colubridae, Genus: Thamnophis, Species: T. sirtalis), and the Meadow vole (Phylum: Chordata, Class: Mammalia, Order: Rodentia, Family: Cricetidae, Genus: Microtus, Species: Mynomes). The presence of berries and trees would serve as both food and shelter for the Robin and Woodpecker. Additionally, the Mid-Atlantic climate is condusive to the survival of all of these organims. The low-lying brush would be a preferable habitat for the meadow vole.
A community is a group of species that interact in a habitat. The two birds compete for food, while the snake is a predator, the vole acts as prey, and the black squirrel competes with the vole for food. Carrying capacity is the maximum population size a habitat can sustain. As these species are acting as food sources for one another, the population numbers of each species will be determinant of the capacity for the other reliant species. Several trophic levels are represented in this community. The primary producers, the plants, in our transect are consumed by primary consumers like meadow voles and black squirrels.
CKL
3/2/16 16S Sequence Analysis
Purpose: Amplify the DNA of bacteria collected from Transect 3 and analyze.
Materials and Methods:
After allowing bacteria to grow in a Hay Infusion Culture for a week, a sample was extracted from one normal agar plate and one tet+ treated agar plate to amplify the 16S rRNA gene. As this gene is specific to each species of bacteria, it will allow us to identify the species present in our agar. A small scrape of each samples was placed in their own PCR tubes with 20 µl of a primer/water mixture and then was mixed. The tubes were then placed in a PCR machine and later run through an agarose gel.
After collection, the sequence obtained will be run through a database BLAST search on Ensembl Bacteria. By matching the P16 sequence to that of a particular type of bacteria, we will be able to find the species present in our transect.
Discussion and Conclusions:
The PCR did not work for any students in our class, likely due to a primer error. Instead, to categorize bacterial life in Transect 3, we looked at previous lab entries from students who have collected this information in the past. Below is the 10^-3 Sequence and the 10^-3 tet+ sequence from a lab last year. When plugged into the website, the first is said to be an uncultured bacterium, meaning the bacteria could not be identified. However, the second (tet+) sample was determined to be variovorex paradoxus. This type of bacteria is gram negative, so it is likely that when tested with a gram stain, the 10^-3 tet+ sequence would also be gram negative. Additionally, this bacteria is motile and form spotted yellow colonies. These trait were likely present in the observed agar plate.
10^-3 Sequence: NNNNNNNNNNGNNGCNNNNNTGCAGTCGAACGGGGTANGCGTAANGCTGCTNCTAGAGGGGGAGAGGGGTGCGTGAGGGC NNAGCGTCTGACTGACCGCGGGAGAGGGGTTGAAANAGGAACGCTAAAACCATGAACGTCACAGAGGAAAAGGCGGGAGA CGGTGGCCTTTTGCTCTATTTAATGATNATGGGTGGGAGCCCGAGANGGTGGTGGTNNTCNCCGTAANGGNAAGATGTAT ATGGGGTCAGAGAANAAGCTNAGACNCAGAGAAACTGAGACAGCGTCCAGACTCATACGGGGGGNGGGTGTGGAATTTGG GGCAATGGGGGAAAGGGCCATATCCAGCCGTGCCGCGTGTGCGAAGAACGCCTGAGTTTTGCCCTGCTTTTTGTCTTGNG ATGAAGGCCAGGAATAAAATATTCTACNCTTGTGATTCTGACTGTACAAAAAGAATAAGGACCGGCTAACTCCGTGCCCG CAGCCGCGGTAATACGGAGGATGCTAGCGTTATTCAGATTTATTGGGTTTAACGCGTGCGTATGCGGTCTTTTAATTCAA TGGTCAAATACTCTACCTCAACTGTCGCATTGCCTTTGATACTGTAGTACTTGAGTCTGTTTGANGTGNGTGCAATTACA CGTGTAACGGTGATATNCATANATATGTCNNGGANCTCCNATTGCGNNNGCCTCTCCCTANNCTNNCACTGACGCTNATG CACGAANGNNNNNGGATCGAACAGGATTACATACNCTCNNNNNCCACNCCCTANACAATTATAACTTGATGTTTGNNAAG ACAAAANNCTNCCCNCCCNCCCCAANCNTTTNNTTNNTNNNCCTNNGGAGGAGGNNCNCCCNGGTGAANACTCNNNNGNN TTTNNNNNCNGNCNNCACNCNCNCANNANNNGNNNNNNNNNNNNNNTNATACNNNAANNAACCNTGCNNCCCCTCCTTNN NNNNNGGGGGNNGNGGANAANNANNNNNNNNNNGNTNNNNNNNNNNANGANGNAANNNNNNNNNGGNGGGGNNNNNNNNN NNNNNNNTNTTNNTANNNNNANNNGGNGNNNNNANCNNCNNNNNGTNNNNN 10^-3 tet Sequence: NNNNNNNNNCNTANNNTGCAGTCGTANCAANGTAGCCNNNNNNTCCTGGCGGCGAGTGGCGAACGGGTGAGTAATACATC GGAACGTGCCCAATCGTGGGGGATAACGCAGCGAAAGCTGTGCTAATACCGCATACGATCTACGGATGAAAGCAGGGGAT CGCAAGACCTTGCGCGAATGGAGCGGCCGATGGCAGATTAGGTAGTTGGTGAGGTAAAGGCTCACCAAGCCTTCGATCTG TAGCTGGTCTGAGAGGACGACCAGCCACACTGGGACTGAGACACGGCCCAAACTCCTACGGGAGGCAGCAGTGGGGAATT TTGGACAATGGGCGAAAGCCTGATCCAGCCATGCCGCGTGCAGGATGAAGGCCTTCGGGTTGTAAACTGCTTTTGTACGG AACGAAACGGCCTTTTCTAATAAAGAGGGCTAATGACGGTACCGTAAGAATAAGCACCGGCTAACTACGTGCCAGCAGCC GCGGTAATACGTAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGTGCGCAGGCGGTTATGTAAGACAGTTGTG AAATCCCCGGGCTCAACCTGGGAACTGCATCTGTGACTGCATAGCTAGAGTACGGTAGAGGGGGATGGAATTCCGCGTGT AGCAGTGAAATGCGTAGATATGCGGAGGAACACCGATGGCGAAGGCAATCCCCTGGACCTGTACTGACGCTCATGCACGA AAGCGTGGGGAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCCTAAACGATGTCAACTGGTTGTTGGGTCTTCACTG ACTCANTAACNAAGCTAACGCGTGAAGTTGACCGCCTGGGGAGTACGGCCGCAAGGTTGAAACTCAAGGAATTGACGGGG ACCCGCACNAACGGTGGATGATGTGGTTTAATTCNATGCAACNCNAAAAACCTTACCCACCTTTGACATGTACGGAATTC NNCAGANNTNGCTTANGGCTCNAANNANAACCGTTACACNGNTGCTGCATGGNNGTCNTCAGCTCGTGTCNNGAGNNNNT NGGGNTAANTCCCGNAACNAGCNCNNACCCNNTGNNN
CKL
2/24/16 Invertebrates and Vertebrates
Purpose: The goal of this lab was to identify and learn about invertebrates and vertebrates within Transect 3.
Materials and Methods:
First, we observed examples of acoelomates, pseudocoelomates, and coelomates under a microscope and noted their unique cross-section structures. Arthropod examples were observed as well.
Next, the Burlese Funnel that had been prepared the week prior was taken apart and the top 15 mL of liquid was poured into one petri dish while the bottom 15 mL was poured into a second petri dish. Both samples were examined for invertebrates. Using a dichotomous key for Insecta, we identified the invertebrates we found. Finally, we considered the vertebrates may live in Transect 3.
Discussion/ Conclusions:
We identified three invertebrates in the sample from the top 15 mL, but there were none in the bottom sample. This suggests that the top environment was a better habitat for the invertebrates we found. The sizes of the organisms ranged from 400 mm to 2000 mm, with the Termite being the smallest and the Annelida being the largest. Insects were most prevalent in the top layer of ethanol from the leaf litter. See Table 1 below for details about the identified organisms.
Five possible vertebrates that exist in transect 3 include the Black Squirrel (Phylum: Chordata, Class: Mammalia, Order: Rodentia, Family: Sciuridae, Genus: Sciurus, Species: S. carolinesis) American Robin (Phylum: Chordata, Class: Aves, Order:Passeriformes, Family: Turdidae, Genus: Turdus, Species: T. migratorius), Red-headed Woodpecker (Phylum: Chordata, Class: Aves, Order: Piciformes, Family: Picidae, Genus: Melanerpes, Species: M. erythrocephalus), Eastern Garter snake (Phylum: Chordata, Class: Reptilia, Order: Squamata, Family: Colubridae, Genus: Thamnophis, Species: T. sirtalis), and the Meadow vole (Phylum: Chordata, Class: Mammalia, Order: Rodentia, Family: Cricetidae, Genus: Microtus, Species: Mynomes). The presence of berries and trees would serve as both food and shelter for the Robin and Woodpecker. Additionally, the Mid-Atlantic climate is condusive to the survival of all of these organims. The low-lying brush would be a preferable habitat for the meadow vole.
A community is a group of species that interact in a habitat. The two birds compete for food, while the snake is a predator, the vole acts as prey, and the black squirrel competes with the vole for food. Carrying capacity is the maximum population size a habitat can sustain. As these species are acting as food sources for one another, the population numbers of each species will be determinant of the capacity for the other reliant species. Several trophic levels are represented in this community. The primary producers, the plants, in our transect are consumed by primary consumers like meadow voles and black squirrels.
CKL
2/17/16Plants and Fungi
Purpose: The purpose of this lab is to document and classify the plantae and fungi that exist within Transect 3.
Materials and Methods:
A leaf litter and 5 samples of plant life (leaves, berries, twigs) were collected from Transect 3 and placed into a plastic Ziploc bag. Under a microscope, the shape, size, and arrangement of transect plant life samples were observed and recorded. Any seeds that were present in the leaf litter were dissected from the plant and observed. In preparation for lab next week, a burlese funnel was created with the leaf litter to collect invertebrates.
In order to learn more about fungi and plant life, we also observed pre-prepared samples. The moss Mnium was observed and compared to a Lily plant stem in order to determine differences in vascularization. Also, the zygomycete, Rhizopus stolonifer was observed.
Data and Conclusions:
Plant samples documented and collected included long grass from the top right corner of the transect, a large tree from the center back, a low lying bush from the front center, a prickly bush from the top right corner, and a medium sized bush from the center (see map of transect in previous lab for spatial reference). All of the samples collected are plants. The vascularization of all of the plants was characterized by xylem and phloem. The height of plant 1 was 37 cm, plant two was 21 cm, plant 3 was 12.7 cm, plant 4 was 11.4 cm, and plant 5 was 11 cm. Due to the season, no seeds were found in the plant samples so we were unable to categorize them as monocot or dicot. See Table 1 and Photos 1-5 below.
Fungi sporangia are the spores that allow the fungi to sexually reproduce.
Photo 1: Low lying brush
Photo 2: Medium sized bush
Photo 3: Tall grass
Photo 4: Large Tree
Photo 5: Prickly bush
Table 1
CKL
2/10/16 Microbiology and Identifying Bacteria
Purpose: The goal of this lab was to identify species of bacteria found in our transects based on motility, gram stains, morphology, and PCR.
Materials and Methods:
In the previous lab session, a serial dilution of water from our transect’s Hay Infusion was made and applied to petri dishes to prepare for this week. Bacteria was allowed to grow for one week on nutrient agar and an antibiotic treated nutrient agar (treated with tetracycline). Tetracyclines inhibit protein synthesis in certain bacterias by blocking the attachment of aminoacyl-tRNA to an acceptor site (Chopra and Roberts 2001). Bacteria like Escherichia coli and Haemophilus influenzae can be sensitive to tetracycline, but certain strains may develop resistance (Chopra and Roberts 2001). The colonies were observed after the week.
Wet mounts were prepared from two nutrient agar colonies and two tet+ colonies and a gram stain was conducted. To stain the wet mounts, first the bacteria was fixed onto the plate by passing the glass slide over a flame three times. The bacterial smear was covered in 1) crystal violet for one minute, 2) rinsed with water, 3) Gram’s iodine mordant for one minute, 4) rinsed with water, 5) decolorized with 95% alcohol for 10-20 second, 6) rinsed with water, 7) blotted. The gram stained colonies were then observed under the microscope.
Finally, a PCR was set up with bacteria from one tet+ agar and one nutrient agar. The primers used were attempting to amplify the 16S rRNA gene, which is unique to each species of bacteria.
Data and Conclusions:
When observing the colony morphology of the nutrient agar and the tet+ agar, it was apparent that the plates with antibiotics had much less growth than the plates that were not treated with tetracycline (Table 1). However, some bacterial colonies persisted in the presence of tet+, indicating that those bacteria are resistant to the antibiotic. Based on my observations, 3 species of bacteria were unaffected by the tetracycline.
When observed under the microscope, the four bacterial smears were all found to have no motility. The size of the colonies on the nutrient agar plates were generally larger and had more gram positive results than the tet+ treated agar (Table 2). Below you can find pictures of the four colonies observed (Figures 1-4).
Table 1
Table 2
Figure 1: Nutrient Agar 10^-9
Figure 2: Nutrient Agar 10^-7
Figure 3: TET+ Agar 10^-3
Figure 3: TET+ Agar 10^-5
Sources:
Chopra, Ian, and Marilyn Roberts. "Tetracycline antibiotics: mode of action, applications, molecular biology, and epidemiology of bacterial resistance." Microbiology and molecular biology reviews 65.2 (2001): 232-260.
CKL
2/3/16
Protists and Algae From Hay Infusion
Purpose: The goal of this lab was to observe protists and algae in a hay infusion and identify their species by learning how to use a dichotomous key.
Materials and Methods
The week prior to this lab, hay infusions were prepared from samples taken at transect 3 on American University’s campus. 12 grams of soil and vegetation, 500 mLs of deerpark water and 0.1 gram of dried milk were mixed in a glass jar and allowed to sit for a week. Observations of the hay infusion were made. Then, samples were taken from two niches– the top and bottom of the jar– and placed on wet mounts. Organisms may differ in each niche because some may feed on plant matter or thrive in darkness while others may prefer to be near the top of the container where there is light.
After that, a serial dilution was made to prepare for next week’s lab. Starting with four tubes with 10 mL of sterile broth, 100 uL of liquid from the Hay infusion were pipetted into the first tube, labeled 10^-2. 100 uL from the 10^-2 tube was put into the next tube, labeled 10^-4. This process was repeated to create tubes with 10^-6 and 10^-8 dilutions. From each dilution, 100 uL was plated onto an agar plate and a tet+ plate, making a 10^-3 dilution. The same was done with the 10^-4 dilution on 10^-5 plate, the 10^-6 dilution on the 10^-7 plates, and the 10^-8 dilution on the 10^-9 plates. The plates were then incubated at room temperature for one week. Below is a diagram explaining the serial dilution.
Data and Conclusions
When observing the Hay Infusion, the water was a murky brown color and there was a thin white film with brown fuzzy matter covering the surface. It smelled similar to decomposing leaves. The white film on top was the only apparent life. From the wet mounted samples, we used the dichotomous key to determine organisms present. In the top niche, there were Peranema (motile, protozoa, not photosynthesizing, 100 um), Arcella (motile, protozoa, not photosynthesizing, 100 um), and Oedogonium (non-motile, algae, photosynthetic, 70 um). In the bottom niche, there were Colpidium (motile, protozoa, not photosynthetic) and Oedogonium (non-motile, algae, photosynthetic, 70 um). We were unable to find a third organism type for the bottom niche. Images of Peranema and Colpidium are included below.
Arcella is a type of amoebae that reproduces asexually. To eat, arcella engulf their food in their pseudopods. Generally, they eat diatoms, green algae or small protozoa. They thrive in wet environments like foliage, marshes and ponds.
If the Hay Infusion Culture were to continue to "grow" for another two months, I would predict that 1) there would be greater decomposition of the leaf litter and 2) the populations of protozoa a algae would increase in size. However, pressures for food and space would result from the population increases.
Hay Infusion Wet Mount: Top Niche with Peranema
Hay Infusion Wet Mount: Bottom Niche with Colpidium
CKL
1/19/16
AU Site 3 Transect Observations
Purpose:
The purpose of this lab was to create an aerial map of a 20 by 20 meter transect (site 3) and observe the abiotic and biotic components of this ecosystem. Additionally, samples were collected to observe protist life in the transect.
Materials and Methods:
To create an aerial map of the 20 by 20 meter transect, a map was first hand-drawn and later refined by using Google Earth images. Popsicle sticks marked the edges of Transect 3. While drawing the map, topography, abiotic, and biotic features were considered.
A representative sample of soil/ ground vegetation was collected randomly throughout the transect and placed into a plastic bag. The sample was used in a Hay Infusion Culture to study protist life present in the transect. Data and Conclusions:
Transect 3 is located in the American University arboretum with the Woods-Brown Amphitheatre to the North and Bender arena to the West. As for topography, the Western and Eastern edges of the transect are sloping down, but the land peaks on the left and right sides of the sidewalk. There is a depression in the land where the middle sidewalk is. All of the land in the transect is landscaped, with black plastic and mulch placed on site.
While observing the transect, many abiotic and biotic components were evident. Abiotic factors included (1) a light post, (2) black plastic under the mulch, (3) cigarettes, (4) rocks, and (5) concrete sidewalk. Biotic factors included (6) a large tree, (7) a bush, (8) lichen, (9) low shrubs, and (10)a spider. Below is an aerial map of transect 3 and the biotic/ abiotic factors within it labeled by the above numbers.
CKL
