User:Anthony Salvagno/Notebook/Research/2011/01/14/pBSTxi Primer Designing

From OpenWetWare
Jump to navigationJump to search

I have a 5kb vector and I want to make a 4.4kb PCR product with it. The sequence actually cloned in reverse, so we want the reverse primer to be dig labeled. I am using this site for primer design.

Results

Sequence Fasta File
Based on the results I got it looks like these primers are suitable:

  • Forward (F50)
    • TGTGTCGCCCTTAGGTACGAACT
  • Reverse (R4500)
    • CTGACTCGCTGCGCTCGGTC
      • Steve Koch 16:42, 28 January 2011 (EST): Binds bottom strand of plasmid ending at 4488

That makes the product 4.4kb and will yield a small fragment after digestion that can be removed via PCR cleanup (less than 100bp).

  • New Reverse Primer (R4000)
    • TTCGCTCCAAGCTGGGCTGTGTG
      • Binds Bottom Strand ending at 4092. This will make the product 4kb instead of 4.4kb, but should yield one product instead of two like the primer above.