User:Ana Isabel F. Simoes/Notebook/Ana Simoes-biomol/2010/03/02

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Next entry

TP1

Exercício

Considere a seguinte representação de uma molécula biológica.

TTGACACTACCGAGGTGTACTATTTTTACCCGAGTCGCTAATTTTTGCCGCAAGGTGCTAAGCCGCGAGG AAAGCGAGGCTGAACAGGCAGTCGCCCGTCCACAGGTGACGGTGATCCCGCGTGAGCAGCATGCTATTTC CCGCAAAGATATCAGTGAAAATGCCCTGAAGGTAATGTACAGGCTCAATAAAGCGGGATACGAAGCCTGG


Lembre-se que qualquer representações tem subjacente um conjunto de convenções.

  • Que moléculas se podem representar desta forma e que convenções estarão implícitas nos diferentes casos?
  1. DNA (genes, cDNA, promotores...)
  2. RNA T-->U (mRNA, tRNA, rRNA)


  • Supondo que se trata de DNA, indique uma forma de apresentação alternativa que represente melhor a sua estrutura real.

DNA na zona codificante para uma proteina pode ser representado por Tripletos. Como uma molecula de DNA tem 2 cadeias complementares e anti-paralelas podemos representa-la dessa forma, por exemplo: 5' TTGACACTACCGA... 3' 3' AACTGTGATGGCT... 5'


  • Poderá esta sequência conter um gene? Justifique a sua resposta.

Pode, se corresponder a um transcrito de RNA obtido a partir desta molecula. Neste caso e se este fragmento contiver o codão de iniciaçao e um codão de stop isto implica que se trata de um gene que codifica para uma proteina.


  • Indique o resultado da transcrição desta sequência.

Convenciando que a sequência anterior corresponde à cadeia codante do gene, estando orientada de 5' para 3', assim o transcrito correspondente será:


5' UUGACACUACCGAGGUGUACUAUUUUUACCCGAGUCGCUAAUUUUUGCCGCAAGGUGCUAAGCCGCGAGG AAAGCGAGGCUGAACAGGCAGUCGCCCGUCCACAGGUGACGGUGAUCCCGCGUGAGCAGCAUGCUAUUUC CCGCAAAGAUAUCAGUGAAAAUGCCCUGAAGGUAAUGUACAGGCUCAAUAAAGCGGGAUACGAAGCCUGG 3'


  • É possível prever que proteína se encontra codificada numa sequência nucleotídica?

Como?

sim é possivel, analisando a correspondencia entre tripletos e aminoacidos nos 6 quadros de leitura possiveis. Nesse caso deveremos encontrar uma leitura continuada dos tripletos e de forma não interrompida, por codões stop. Isso significa que corresponde a um fragmento de sequencia codificante para uma proteina. Ou então, se a sequencia contiver o codão iniciador e o codão stop no mesmo quadro de leitura.


  • A sequência apresentada codifica alguma proteína?

Consulte aqui o código genético


  1. 5'3' Frame 1

L T L P R C T I F T R V A N F C R K V L S R E E S E A E Q A V A R P Q V T V I P R E Q H A I S R K D I S E N A L K V Met Y R L N K A G Y E A W


  1. 5'3' Frame 2

Stop H Y R G V L F L P E S L I F A A R C Stop A A R K A R L N R Q S P V H R Stop R Stop S R V S S Met L F P A K I S V K Met P Stop R Stop C T G S I K R D T K P


  1. 5'3' Frame 3

D T T E V Y Y F Y P S R Stop F L P Q G A K P R G K R G Stop T G S R P S T G D G D P A Stop A A C Y F P Q R Y Q Stop K C P E G N V Q A Q Stop S G I R S L


  1. 3'5' Frame 1

P G F V S R F I E P V H Y L Q G I F T D I F A G N S Met L L T R D H R H L W T G D C L F S L A F L A A Stop H L A A K I S D S G K N S T P R Stop C Q


  1. 3'5' Frame 2

Q A S Y P A L L S L Y I T F R A F S L I S L R E I A C C S R G I T V T C G R A T A C S A S L S S R L S T L R Q K L A T R V K I V H L G S V


  1. 3'5' Frame 3

R L R I P L Y Stop A C T L P S G H F H Stop Y L C G K Stop H A A H A G S P S P V D G R L P V Q P R F P R G L A P C G K N Stop R L G Stop K Stop Y T S V V S


De todas as possibilidades, apresentadas em cima, temos a Frame 1 de 5'3' e a Frame 2 de 3'5' que apresentam um quadro de leitura nao interrompido por codões de stop podem por isso corresponder a uma parte de uma sequencia codante de uma proteina. Alem disso, a Frame 1 de 3'5' contem uma sequencia que codifica para uma ORF (contém uma sequencia de tripletos que codifica para um peptido de 24 aa comecando no codão iniciador -metionina- e um codão stop, no mesmo quadro de leitura)


  • Que diferenças encontra se em vez de aplicar o código genético standard aplicar a variante bacteriana?

Surgem diferenças porque a leitura do codigo genetico nas bacterias nao e identica à do codigo genetico standard, ou seja, um mesmo tripleto pode codificar para aminoacidos diferentes, ou um aminoacido num caso e um codao stop noutro.

(é preciso comparar a traduçao da sequencia anterior obtida pelo código genético standard com a traduçao obtida pelo codigo genetico variante bacteriana)


  • Como poderia saber de que organismo provém esta sequência?

Comparava-se esta sequencia com todas as sequencias que se encontram no banco de dados que estao disponiveis no ncbi. Para isso deve-se utilizar O BLAST.


Conceitos a ter no final desta aula:

Estrutura do DNA e RNA

Região 5’ e 3’

Sequência complementar e complemento reverso

Transcrição, direcção da transcrição

Quadro de leitura, quadro de leitura aberto, código genético



Personal tools