Urban and Runyon

From OpenWetWare

Jump to: navigation, search

Nitrate Sensor Project

Novel Bio Bricks Part:

Long Description: To develop a functional nitrate sensor, our group is attempting to couple the two-component Nar pathway to an RFP reporter to observe RFP expression in response to different concentrations of nitrate. Because our sensor needs to be able to detect nitrate levels of 10 ppm (the MCL designated by the EPA), our group decided to create a part containing the NarL coding sequence. We plan on inserting the NarL cds downstream of a RBS and constitutive promoter in order to potentially enhance the signal of RFP expression in response to nitrate activation of the two-component pathway. Nitrate detection levels based on data by Edinburgh iGEM team 2009 [1]

Short Description: Coding sequence for NarL protein in accordance with BioBrick assembly 10 standards

Sequence:

gaattcgcggccgcttctagATGAGTAATCAGGAACCGGCTACTATCCTGCTGATTGACGATCACCCGATGCTGCGAACTGGCGTAAAACAGCTTATCAGTATGGCACCAGATATCACCGTGGTTGGCGAAGCGAGTAATGGCGAACAGGGTATTGAACT GGCGGAGTCTCTTGATCCCGATCTGATCCTGTTAGATCTCAATATGCCCGGCATGAACGGTCTGGAAACG CTGGATAAACTGCGCGAAAAGTCCCTCTCAGGGCGCATTGTGGTATTCAGCGTCTCTAACCATGAAGAAG ATGTGGTCACCGCACTGAAACGCGGCGCGGATGGCTATCTGTTAAAAGATATGGAACCGGAAGATCTGCT GAAAGCATTGCATCAGGCAGCTGCTGGCGAAATGGTATTAAGCGAAGCATTAACGCCTGTTCTGGCCGCC AGCTTGCGCGCTAACCGTGCCACTACTGAGCGCGATGTTAACCAGTTAACCCCACGCGAGCGCGATATTC TCAAGCTGATTGCCCAGGGTTTGCCGAACAAGATGATTGCCCGCCGCCTGGATATCACCGAAAGCACAGT AAAAGTGCACGTCAAGCACATGCTGAAGAAAATGAAGCTCAAGTCTCGCGTGGAAGCAGCGGTATGGGTG CATCAGGAGCGCATTTTCTAAtactagtagcggccgctgcag

Natural NarL sequence did not contain any EcoRI, PstI, SpeI, or XbaI restriction sites. NarL part is therefore usable by BioBrick Assmebly 10 standards.

References:

Personal tools