OWW Signup Concerns: If you applied to join OpenWetWare this week and have not received a confirmation email message and/or a verification reply, please re-submit your application.
Thanks.

Tiffany Guo

From OpenWetWare

Jump to: navigation, search

Contents

About me

Name: Tiffany Guo
Course/Minor: 20/5
Year of Graduation: 2009
Email: tiffguo
Current Classes: 5.03, 6.00, 20.109, 21F.108

Module 1: Genome Engineering

Day 1: Start up Genome Engineering

protein function re-engineering ideas
I assembly modify gene to that multiple channels can be made, and thus mature phage secretion is accelerated
II replication of DNA + strand modify so it can nick foreign DNA (e.g. the E. Coli's) and the phage can replicate and package a portion of the host DNA
III phage tail protein (5 copies) modify end of protein so that it can bind to other cells (and infect other cells) besides E. Coli
IV assembly modify gene to that multiple channels can be made, and thus mature phage secretion is accelerated
V binds ssDNA allow it to sequester double stranded DNA also, then it can be used as a vector for infecting cells with desired DNA fragments.
VI phage tail protein (5 copies) delete to learn more about its function.
VII phage head protein (5 copies) delete to learn more about its function.
VIII phage coat protein (2700 copies) tag it (perhaps with flourescence) to learn more about phage coat assembly
IX phage head protein (5 copies) modify so that it can act similarly to pIII
X DNA replication make pX more active so that more + strands will accumulate, allowing the host cell to produce even more phages.
XI assembly modify gene to that multiple channels can be made, and thus mature phage secretion is accelerated

Day 4: Genome Refactoring

I refactored the phate genome to remove overlaps in the genome and to add in restriction enzyme sites between each part. I edited codons to retain amino acid sequence while weakening the rbs or promoter. Considerations: 1) eliminate rbs and promoters within genes: took into consideration codon changes that would not change amino acid sequences but would decrease the strength of the rbs or promoter. 2) add restriction sites between each part: tried to keep sticky ends as consistent as possible (i.e. after every promoter, the restriction site sticky end is 3'ctag), however, there aren't enough zero cutting isoschizomers

On the parts registry, my part is BBa_M31975.

New Parts: a) restriction enzyme sites

restriction enzyme code parts number
Acc65I G^GTAC_C BBa_M31997
AvrII C^CTAG_G BBa_M31994
AscI GG^CGCG_CC BBa_M31990
BsiWI C^GTAC_G BBa_M31996
SpeI A^CTAG_T BBa_M31992
BssHII G^CGCG_C BBa_M31989
BsrGI T^GTAC_A BBa_M31995
MluI A^CGCG_T BBa_M31988
BclI T^GATC_A BBa_M31987
EagI C^GGCC_G BBa_M31986
BglII A^GATC_T BBa_M1985
NheI G^CTAG_C BBa_M31993
PspOMI G^GGCC_C BBa_M31984
EcoRI G^AATT_C BBa_M31983
XbaI T^CTAG_A BBa_M31991
NotI GC^GGCC_GC BBa_M31982
MfeI C^AATT_G BBa_M31976

b) Trancription terminator

part number code
BBa_M31977 tacaattaaaggctccttttggagcctttttttt

c) coding sequences:

gene parts number parts removed # bp changed code (bp changed are capitalized)
5 BBa_M31981 rbs 7, restriction site BsrGI 3 atgattaaagttgaaattaaaccatctcaagcccaatttactactcgttctggtgtttctcgtcagggcaagccttattc

actgaatgagcagctttgttacgttgatttgggtaatgaatatccggttcttgtcaagattactcttgatgaaggtcagc cagcctatgcgcctggtctgtaTaccgttcatctgtcctctttcaaagttggtcagttcggttcccttatgattgaccgt ctgcgcctcgttccAgctaaCtaa

7 BBa_M31980 rbs 9, promoter 8 6 atggagcaggtcgcggatttcgacacaatttatcaggcgatgatacaaatctccgtAgtactGtgtttcgcgctGggCat

TatcgctgggggCcaaagatga

9 BBa_M31978 rbs 8 1 atgagtgttttagtgtattctttcgcctctttcgttttaggttggtgccttcgtagtggcattacgtattttacccgttt

aatggaaacttcAtcatga

Module 2: Calcium Signalling

Day 4: Calcium Signalling In-Vivo

DNA Mock 1/2 DNA
Mock
Untreated
Histamine (0.2mM)
EGTA (2mM)
Personal tools