The BioBricks Foundation:BBFRFC10

From OpenWetWare

Jump to: navigation, search
             Draft Standard for Biobrick Biological Parts

                              Tom Knight
                              3 May 2007

This standard defines the required sequence properties for a
Biobrick(tm) standard biological part.  It does not define any
functional characteristics of the parts, nor does it motivate any
aspect of these standards.  All sequences defined herein are specified
in the 5' to 3' direction.

0. A Biobrick compatible standard biological part consists of a DNA
   fragment potentially conveying informational or functional
   properties to a composite structure assembled from multiple parts.
   The current assembly process requires certain sequence properties
   for the part and the surrounding DNA.


1. Allowed sequences within Biobrick parts include any DNA sequence
   which does not contain the following subsequences:

   EcoRI site:   GAATTC
   XbaI site:    TCTAGA
   SpeI site:    ACTAGT
   PstI site:    CTGCAG
   NotI site:    GCGGCCGC

   Additionally, there are a set of sites which, if convenient, should
   also be eliminated.  Parts containing these sites qualify as fully
   Biobrick standard compliant, but future assembly and advanced uses
   of the parts may be compromised.  These include:

   PvuII site:   CAGCTG
   XhoI site;    CTCGAG
   AvrII site:   CCTAGG
   NheI site:    GCTAGC
   SapI site:    GCTCTTC and GAAGAGC


2. Biobrick Suffix

   Each Biobrick part must contain precisely this sequence immediately
   following the 3' end of the part:

   T ACTAGT A GCGGCCG CTGCAG
   (note: if constructing a primer, this sequence must be reverse
   complemented.)


3. Biobrick Prefix:

   To allow the construction of ribosomal binding sequences 5' of
   coding regions, the prefix used for coding regions is distinguished
   from the sequence for non-coding Biobrick parts.

   a. For non-coding Biobrick parts (the default) the Biobrick part
      must contain precisely the following sequence immediately 5' of
      the part:

      GAATTC GCGGCCGC T TCTAGA G



   b. For Biobrick parts coding for proteins, the Biobrick part must
      contain precisely the following sequence immediately 5' of the
      ATG start of the coding region:

      GAATTC GCGGCCGC T TCTAG

      Parts containing start codons other than ATG must be modified to
      use ATG as the start codon.  We highly recommend, but do not
      require, that all coding regions terminate with in-frame TAATAA
      stop codons, replacing other stop codons (TGA, TAG).


4. Plasmid context

   Biobrick parts must be supplied in plasmids compatible with
   registry and assembly procedures.  The pSBxxxx series of plasmids
   comply with these requirements.  Other plasmids may be compliant
   with the following constraints:

   a. Antibiotic resistance:

      All plasmids must carry at least one of the following antibiotic
      resistance markers:

      Ampicillin
      Chloramphenicol
      Kanamycin
      Tetracycline

      It is acceptable for a plasmid to convey both ampicillin
      resistance and no more than one additional antibiotic resistance
      markers.

      Note that certain strains convey resistance as well.  Parts
      delivered to the registry must be in strains which do not convey
      resistance to these markers.


   b. Sequencing primers

      The registry uses the following primers in sequencing all parts.
      Plasmids which omit or misplace these primers cannot be
      sequenced:

      VF2:  TGCCACCTGACGTCTAAGAA
      VR:   ATTACCGCCTTTGAGTGAGC



5. Strains

   The registry maintains parts libraries in frozen bacterial
   cultures, and encourages submissions in this form.  The bacterial
   strain must be a K-12 cloning strain (endA-).  Under no
   circumstances will the registry accept submissions in any strain
   which is not BSL-1.  We recommend strains such as Top10, DH10B, and
   DH5a.  We do not recommend submissions in MC4100, BL21 and similar
   strains.


6. PCR contruction of Biobrick parts

   Biobrick parts can be constructed by PCR from naturally occurring
   coding regions or other long DNA sequences.  The recommended primer
   sequences for PCR of these fragments are:

   Biobrick prefix:
   GTTTCTTC GAATTC GCGGCCGC T TCTAGA G <18-24 bp of matching primer>

   Coding region biobrick prefix:
   GTTTCTTC GAATTC GCGGCCGC T TCTAG <18-24 bp of matching primer, beginning with ATG>

   Biobrick suffix:
   GTTTCTTC CTGCAG CGGCCGC T ACTAGT A <18-24 bp of matching primer (reverse complement)>

   The reverse complement of this suffix sequence is:
   3' T ACTAGT A GCGGCCG CTGCAG GAAGAAAC 5'


------------
Biobrick(tm) is a registered trademark of the Biobrick Foundation, Inc.

Personal tools