Template:SBB12Project stdt1215
From OpenWetWare
![]()
Welcome to your project page!
I've given you two parts to make.
- Design oligos to make your part
- Write up a proper construction file on the wiki template associated with your part
- Enter your Features (REMEMBER: It's not a bug, it's a feature. We just don't know what it does yet), Oligos, Parts, and Plasmids into Clotho
Also, use the link above left to upload a picture of yourself, your name, and anything else you'd like, and rename the link from "Your Name Here" to your name.
Finally, you should create a notebook on the on the main class page of the wiki
Partname: sbb1227 Featurename: Leu8 Genename: n/a Source: Synthetic
Just a big hydrophobic patch of 8 leucines, or LLLLLLLL*
This part encodes a homodimer domain
You are going to put the homodimer on the C-terminus of a truncated ToxR. For this part, you're going to go off BioBricks. Kindov. Your final product will be a BioBrick, but you are going to use an ad hoc procedure to create it. You should examine this illustration which refers to two sequences: pBca9525-Bca1834 and pBca9525-Bca1839. The important thing here is that you think through the translation frame of the final product, and make sure that you add some linker between your sequence and the sequence 5' to it. You should also remove the start methionine from you homodimer, unless your project description explicitly says not to. You should include the stop codon.
The product of your construction file should resemble pBca9525-Bca1839 in terms of it encoding a full expression cassette containing a ToxR fusion protein with your designed feature. If you were given part sbb1293, your product would be called pBca9525-sbb1293.
Construction File
Wobble tn001F/tn002R (64bp, wobpdt) Digest wobpdt (NheI/BamHI, L, wobdig) Digest pBca9525-Bca1834 (NheI/BamHI, L, vectdig) Ligate wobdig and vectdig (pBca9525-sbb1227) {Leu8} ---------------------------------------------------------------------- >tn001F Forward construction of sbb1227 basic part ccataGCTAGCggcagtggatctggtCTGCTACTGTTGCTG >tn002R Reverse construction of sbb1227 basic part CTGATggatccTTACAGGAGTAGCAGCAACAGTAGCAGaccag >wobpdt ccataGCTAGCggcagtggatctggtCTGCTACTGTTGCTGCTACTCCTGTAAggatccATCAG
Partname: sbb1213 Featurename: lz_AAAA-2 Genename: leucine zipper variant Source: Synthetic, see PMID:12459719
Encode a mutant of the AAAA leucine zipper with the terminal cysteine truncated off. VKEAEDKNEELLSAAYHAANEVARLKKLVGERGG
This part encodes a leucine zipper
We will be using a set of leucine zippers as homodimer domains. In total, we'll have 8 of them all with different Kd's for homodimerization. However, the sequences only differ at the same 4 amino acid sites. This will allow us to test whether the activation of ToxR is dependent on the Kd of the homodimer that is attached to it. These sequences are entirely synthetic, but all should encode the following peptide:
VKELEDKNEELLS XX YH XX NEVARLKKLVGERGGC*Where the x's are the amino acids I tell you. So, if I gave you the lz_IILK zipper to make, the peptide you should encode is: VKELEDKNEELLSIIYHLKNEVARLKKLVGERGGC*
Here is an example of what your trying to make pBca9525-sbb1230.
This part encodes a homodimer domain
You are going to put the homodimer on the C-terminus of a truncated ToxR. For this part, you're going to go off BioBricks. Kindov. Your final product will be a BioBrick, but you are going to use an ad hoc procedure to create it. You should examine this illustration which refers to two sequences: pBca9525-Bca1834 and pBca9525-Bca1839. The important thing here is that you think through the translation frame of the final product, and make sure that you add some linker between your sequence and the sequence 5' to it. You should also remove the start methionine from you homodimer, unless your project description explicitly says not to. You should include the stop codon.
The product of your construction file should resemble pBca9525-Bca1839 in terms of it encoding a full expression cassette containing a ToxR fusion protein with your designed feature. If you were given part sbb1293, your product would be called pBca9525-sbb1293.
Construction File
PCA1 on o15,o11,o12 (pca1) PCA2 with o15/o12 on pca1 (139 bp, pca2) Digest pca2 (NheI/BamHI, L, 1213dig) Digest pBca9525-Bca1834 (NheI/BamHI, L, vectdig) Ligate 1213dig + vectdig, product is pBca9525-sbb1213 ---- >o15 CCATAgctagcGGCAGTGGATCTGTTAAAGAAGCGGAAGACAAAAACGAAGAACTGCTGAGT >o11 CAAAAACGAAGAACTGCTGAGTGCCGCTTACCACGCAGCCAACGAAGTTGCTCGTCTGA >o12 CAGTAGGATCCTTAGCCGCCACGTTCGCCAACCAGTTTTTTCAGACGAGCAACTTCGTT >pca2 CCATAgctagcGGCAGTGGATCTGTTAAAGAAGCGGAAGACAAAAACGAAGAACTGCTGAGTGCCGCTTACCACGCAGCCAACGAAGTTGCTCGTCTGAAAAAACTGGTTGGCGAACGTGGCGGCTAAGGATCCTACTG



