Template:SBB12Project stdt1204

From OpenWetWare
Jump to navigationJump to search

Jonathan "Jon" Kotker

Error creating thumbnail: File missing

Welcome to your project page!

I've given you two parts to make.

  • Design oligos to make your part
  • Write up a proper construction file on the wiki template associated with your part
  • Enter your Features (REMEMBER: It's not a bug, it's a feature. We just don't know what it does yet), Oligos, Parts, and Plasmids into Clotho

Also, use the link above left to upload a picture of yourself, your name, and anything else you'd like, and rename the link from "Your Name Here" to your name.

Finally, you should create a notebook on the on the main class page of the wiki


Partname:     sbb1223
Featurename:  caff_VHH
Genename:     n/a
Source:       synthetic

You will need to synthesize this one using PCA with full E. coli codon usage. What it encodes is a VHH domain of an evolved Camelid antibody. The family of animals including llamas make unusual single-heavy-chain antibodies. When just the business portion of the molecule is employed, it's called a VHH domain. This particular one has been shown to dimerize in response to caffeine (PMID 19572722).

You need to read the paper, its supporting information, and the one it references (PMID 16808459) to figure out the exact peptide sequence you want. This may be easier said than done. If you get stumped, let me know. I do have more sequence info about what we want, but you should try first to figure it out.

This part encodes a homodimer domain

You are going to put the homodimer on the C-terminus of a truncated ToxR. For this part, you're going to go off BioBricks. Kindov. Your final product will be a BioBrick, but you are going to use an ad hoc procedure to create it. You should examine this illustration which refers to two sequences: pBca9525-Bca1834 and pBca9525-Bca1839. The important thing here is that you think through the translation frame of the final product, and make sure that you add some linker between your sequence and the sequence 5' to it. You should also remove the start methionine from you homodimer, unless your project description explicitly says not to. You should include the stop codon.

The product of your construction file should resemble pBca9525-Bca1839 in terms of it encoding a full expression cassette containing a ToxR fusion protein with your designed feature. If you were given part sbb1293, your product would be called pBca9525-sbb1293.


Construction File

PCA1 on caff.01.o01-caff.01.o14           (pca1)
PCA2 with caff.01.o01/caff.01.o14 on pca1 (394 bp, pca2)
Digest pca2                               (NheI/BamHI, L, 1223dig)
Digest pBca9525-Bca1834                   (NheI/BamHI, L, vectdig)
Ligate 1223dig + vectdig, product is pBca9525-sbb1223
----
>caff.01.o01	CCATAGCTAGCGGCAGTGGATCTCAAGTACAACTGGTAGAAAGCGGTGGTG
>caff.01.o02	GGCTACCACCTGCTTGTACCAGACCACCACCGCTTTCTACCAGTTGTA
>caff.01.o03	TGGTACAAGCAGGTGGTAGCCTGCGTCTGAGCTGCACCGCTTCCGG
>caff.01.o04	ACCAAGCCATACTGTAGATGGTTCCTGTACGACCGGAAGCGGTGCAGCTCA
>caff.01.o05	GAACCATCTACAGTATGGCTTGGTTCCGTCAAGCACCAGGTAAAGAACGTGA
>caff.01.o06	GACCAACCAACGGTAGCCAGGAACTCACGTTCTTTACCTGGTGCTTGA
>caff.01.o07	CTGGCTACCGTTGGTTGGTCCTCCGGTATCACCTACTACATGGACAGCGTAA
>caff.01.o08	GTCACGGCTGATGGTGAAACGACCTTTTACGCTGTCCATGTAGTAGGTGA
>caff.01.o09	TCGTTTCACCATCAGCCGTGACAAAGGTAAAAACACCGTATACCTCCAGATGG
>caff.01.o10	CGGTGTCTTCTGGTTTCAGGCTGTCCATCTGGAGGTATACGGTGTTTTT
>caff.01.o11	GCCTGAAACCAGAAGACACCGCAGTTTACTACTGCACCGCTACCCGT
>caff.01.o12	GACCCCAGTAGTCGTAACCAACGGAGTAAGCACGGGTAGCGGTGCAGTAG
>caff.01.o13	GTTGGTTACGACTACTGGGGTCAAGGCACCCAAGTAACCGTAAGCAGCTAAG
>caff.01.o14	CTGGAGGATCCTTAGCTGCTTACGGTTACTTGGG
>pca2
CCATAGCTAGCGGCAGTGGATCTCAAGTACAACTGGTAGAAAGCGGTGGTGGTCTGGTACAAGCAGGTGGTAGCCTGCGTCTGAGCTGCACCGCTTCCGGTCGTACAGGAACCATCTACAGTATGGCTTGGTTCCGTCAAGCACCAGGTAAAGAACGTGAGTTCCTGGCTACCGTTGGTTGGTCCTCCGGTATCACCTACTACATGGACAGCGTAAAAGGTCGTTTCACCATCAGCCGTGACAAAGGTAAAAACACCGTATACCTCCAGATGGACAGCCTGAAACCAGAAGACACCGCAGTTTACTACTGCACCGCTACCCGTGCTTACTCCGTTGGTTACGACTACTGGGGTCAAGGCACCCAAGTAACCGTAAGCAGCTAAGGATCCTCCAG


Partname:     sbb1204
Featurename:  lz_EILK
Genename:     leucine zipper variant
Source:       Synthetic, see PMID:12459719 

This part encodes a leucine zipper

We will be using a set of leucine zippers as homodimer domains. In total, we'll have 8 of them all with different Kd's for homodimerization. However, the sequences only differ at the same 4 amino acid sites. This will allow us to test whether the activation of ToxR is dependent on the Kd of the homodimer that is attached to it. These sequences are entirely synthetic, but all should encode the following peptide:

VKELEDKNEELLS XX YH XX NEVARLKKLVGERGGC*

Where the x's are the amino acids I tell you. So, if I gave you the lz_IILK zipper to make, the peptide you should encode is: VKELEDKNEELLSIIYHLKNEVARLKKLVGERGGC*

Here is an example of what your trying to make pBca9525-sbb1230.

This part encodes a homodimer domain

You are going to put the homodimer on the C-terminus of a truncated ToxR. For this part, you're going to go off BioBricks. Kindov. Your final product will be a BioBrick, but you are going to use an ad hoc procedure to create it. You should examine this illustration which refers to two sequences: pBca9525-Bca1834 and pBca9525-Bca1839. The important thing here is that you think through the translation frame of the final product, and make sure that you add some linker between your sequence and the sequence 5' to it. You should also remove the start methionine from you homodimer, unless your project description explicitly says not to. You should include the stop codon.

The product of your construction file should resemble pBca9525-Bca1839 in terms of it encoding a full expression cassette containing a ToxR fusion protein with your designed feature. If you were given part sbb1293, your product would be called pBca9525-sbb1293.

Construction File

PCA1 on o1,o4,o2          (pca1)
PCA2 with o1/o2 on pca1   (142 bp, pca2)
Digest pca2               (NheI/BamHI, L, 1204dig)
Digest pBca9525-Bca1834   (NheI/BamHI, L, vectdig)
Ligate 1204dig + vectdig, product is pBca9525-sbb1204
----
>o1	
CCATAgctagcGGCAGTGGATCTGTTAAAGAACTGGAAGACAAAAACGAAGAACTGCTGAGT
>o2	
CAGTAGGATCCTTAGCAGCCGCCACGTTCGCCAACCAGTTTTTTCAGACGAGCAACTTCGTT
>o4	
CAAAAACGAAGAACTGCTGAGTGAGATCTACCACCTGAAAAACGAAGTTGCTCGTCTGA
>pca2
CCATAgctagcGGCAGTGGATCTGTTAAAGAACTGGAAGACAAAAACGAAGAACTGCTGAGTGAGATCTACCACCTGAAAAACGAAGTTGCTCGTCTGAAAAAACTGGTTGGCGAACGTGGCGGCTGCTAAGGATCCTACTG