Template:SBB10 ConstructionFiles BenB sbb05

From OpenWetWare

Jump to: navigation, search
Construction of sbb05: piggieBac 5'TR

Pool BDBpb001 through BDBpb010, assemble by PCA
PCR BDBpb001/BDBpb010 on PCA reaction	(344 bp, EcoRI/BamHI)
Sub in pBjk2741-Bca1144	(EcoRI/BamHI, 910+2170, L)
Product is pBjk2741-sbb05

------------

BDBpb001	PCA assembly of sbb11	CCATAGAATTCATGAGATCTTTAACCCTAGAAAGATAGTCTGCGTAAAATTGACGC
BDBpb002	PCA assembly of sbb11	GCTATTTAGAAAGAGAGAGCAATATTTCAAGAATGCATGCGTCAATTTTACGCAGACTATC
BDBpb003	PCA assembly of sbb11	GAAATATTGCTCTCTCTTTCTAAATAGCGCGAATCCGTCGCTGTGCATTTAGG
BDBpb004	PCA assembly of sbb11	CTCACGGGAGCTCCAAGCGGCGACTGAGATGTCCTAAATGCACAGCGACGGA
BDBpb005	PCA assembly of sbb11	CGCTTGGAGCTCCCGTGAGGCGTGCTTGTCAATGCGGTAAGTGTCACTGATTTTGA
BDBpb006	PCA assembly of sbb11	CGTCATTTTGACTCACGCGGTCGTTATAGTTCAAAATCAGTGACACTTACCGC
BDBpb007	PCA assembly of sbb11	CCGCGTGAGTCAAAATGACGCATGATTATCTTTTACGTGACTTTTAAGATTTAACTCATACG
BDBpb008	PCA assembly of sbb11	TATCACGTAAGTAGAACATGAAATAACAATATAATTATCGTATGAGTTAAATCTTAAAAGTCACGT
BDBpb009	PCA assembly of sbb11	ATATTGTTATTTCATGTTCTACTTACGTGATAACTTATTATATATATATTTTCTTGTTATAGATATCGGATC
BDBpb010	PCA assembly of sbb11	CTGATGGATCCGATATCTATAACAAGAAAATATATATATAATAA

JCA Notes

  • Correct
Personal tools