Template:SBB10 ConstructionFiles AndrewS sbb14

From OpenWetWare

Jump to: navigation, search
2) sbb14: PhiC31 Integrase
----------------------------------------------------------
PCR AS009-F/AS010-R on pBca9523-Bca1623	(980 bp, gp = A)
PCR AS011-F/AS012-R on pBca9523-Bca1659	(938 bp, gp = B)
----------------------------------------------------------
PCR AS009-F/AS010-R on A+B	(1874 bp, EcoRI/BamHI)
Sub in pBjk2741-Bca1144	(EcoRI/BamHI, 910+2170, L)
Product is pBjk2741-sbb14	{rbs.phiC31>}
----------------------------------------------------------
AS009-F 	Forward PCR of Part 1 of PhiC31 with RBS	 ccataGAATTCatgAGATCTACATACCGAGATCATATATAAGGAGGTACATatgGACACGTACGCGGGTGCTTACG
AS010-R 	SOEing of Part 1 of PhiC31	cggtaaccctcaatcttcgtGGTCGGCGTGCCGTCCGGCTTCTT
AS011-F 	SOEing of Part 2 of PhiC31	AAGAAGCCGGACGGCACGCCGACCacgaagattgagggttaccg
AS012-R 	Reverse PCR of Part 2 of PhiC31	atcagGGATCCCGCCGCTACGTCTTCCGT

JCA Notes

  • BglII site missing from the first oligo
  • Otherwise correct
  • Need to put part into Clotho
sbb14: PhiC31 Integrase
----------------------------------------------------------
PCR AS009-F/AS010-R on Bca1623 6-9         (976bp, gp=A)
PCR AS011-F/CA1674 on Bca1559 7-7          (514bp, gp=B)
PCR CA1675/AS012-R on Bca1559 7-1          (444bp, gp=C)
----------------------------------------------------------
PCR AS009-F/AS012-R on A+B+C	(1868 bp, EcoRI/BamHI)
Sub in pBjk2741-Bca1144	(EcoRI/BamHI, 910+2170, L)
Product is pBjk2741-sbb14	{rbs.phiC31>}
----------------------------------------------------------
AS009-F 	Forward PCR of Part 1 of PhiC31 with RBS	 
ccataGAATTCatgAGATCTCAGATCATATATAAGGAGGTACATatgGACACGTACGCGGGTGCTTACG
AS010-R 	SOEing of Part 1 of PhiC31	
cggtaaccctcaatcttcgtGGTCGGCGTGCCGTCCGGCTTCTT
AS011-F 	SOEing of Part 2 of PhiC31	
AAGAAGCCGGACGGCACGCCGACCacgaagattgagggttaccg
CA1674	GGGCGTCGGCGCGCTCCGCAACAAGGTTCGCCCGTTCGCCGCTCTTCTCAG	
PCA assembly of phiCthreeprime (Bca1659)
CA1675	TGCGGAGCGCGCCGACGCCCTGAACGCCCTTGAAGAGCTGTACGAAGACCG	
PCA assembly of phiCthreeprime (Bca1659)
AS012-R 	Reverse PCR of Part 2 of PhiC31	
atcagGGATCCCGCCGCTACGTCTTCCGT

Part:  GATCTCAGATCATATATAAGGAGGTACATatgGACACGTACGCGGGTGCTTACGACCGTCAGTCGCGCGAGCGCGAAAATTCGAGCGCAGCAAGCCCAGCGACACAGCGTAGCGCCAACGAAGACAAGGCGGCCGACCTCCAGCGCGAAGTCGAGCGCGACGGGGGCCGGTTCAGGTTCGTCGGGCATTTCAGCGAAGCGCCGGGCACGTCGGCGTTCGGGACGGCGGAGCGCCCGGAGTTCGAACGCATCCTGAACGAATGCCGCGCCGGGCGGCTCAACATGATCATTGTCTATGACGTGTCGCGCTTCTCGCGCCTCAAGGTCATGGACGCGATTCCGATTGTCTCGGAATTGCTCGCCCTGGGCGTGACGATTGTTTCCACTCAGGAAGGCGTCTTCCGGCAGGGAAACGTCATGGACCTGATTCACCTGATTATGCGGCTCGACGCGTCGCACAAAGAATCTTCGCTCAAGTCGGCGAAGATTCTCGACACGAAGAACCTCCAGCGCGAATTGGGCGGGTACGTCGGCGGGAAGGCGCCTTACGGCTTCGAGCTTGTTTCGGAGACGAAGGAGATCACGCGCAACGGCCGAATGGTCAATGTCGTCATCAACAAGCTTGCGCACTCGACCACTCCCCTTACCGGACCCTTCGAGTTCGAGCCCGACGTAATCCGGTGGTGGTGGCGTGAGATCAAGACGCACAAACACCTTCCCTTCAAGCCGGGCAGTCAAGCCGCCATTCACCCGGGCAGCATCACGGGGCTTTGTAAGCGCATGGACGCTGACGCCGTGCCGACCCGGGGCGAGACGATTGGGAAGAAGACCGCTTCAAGCGCCTGGGACCCGGCAACCGTTATGCGAATCCTTCGGGACCCGCGTATTGCGGGCTTCGCCGCTGAGGTGATCTACAAGAAGAAGCCGGACGGCACGCCGACCacgaagattgagggttaccgCATTCAGCGCGACCCGATCACGCTCCGGCCGGTCGAGCTTGATTGCGGACCGATCATCGAGCCCGCTGAGTGGTATGAGCTCCAGGCGTGGTTGGACGGCAGGGGGCGCGGCAAGGGGCTTTCCCGGGGGCAAGCCATTCTGTCCGCCATGGACAAGCTGTACTGCGAGTGTGGCGCCGTCATGACTTCGAAGCGCGGGGAAGAATCGATCAAGGACTCTTACCGCTGCCGTCGCCGGAAGGTGGTCGACCCGTCCGCACCTGGGCAGCACGAAGGCACGTGCAACGTCAGCATGGCGGCACTCGACAAGTTCGTTGCGGAACGCATCTTCAACAAGATCAGGCACGCCGAAGGCGACGAAGAGACGTTGGCGCTTCTGTGGGAAGCCGCCCGACGCTTCGGCAAGCTCACTGAGGCGCCTGAGAAGAGCGGCGAACGGGCGAACCTTGTTGCGGAGCGCGCCGACGCCCTGAACGCCCTTGAAGAGCTGTACGAAGACCGCGCGGCAGGCGCGTACGACGGACCCGTTGGCAGGAAGCACTTCCGGAAGCAACAGGCAGCGCTGACGCTCCGGCAGCAAGGGGCGGAAGAGCGGCTTGCCGAACTTGAAGCCGCCGAAGCCCCGAAGCTTCCCCTTGACCAATGGTTCCCCGAAGACGCCGACGCTGACCCGACCGGCCCTAAGTCGTGGTGGGGGCGCGCGTCAGTAGACGACAAGCGCGTGTTCGTCGGGCTCTTCGTAGACAAGATCGTTGTCACGAAGTCGACTACGGGCAGGGGGCAGGGAACGCCCATCGAGAAGCGCGCTTCGATCACGTGGGCGAAGCCGCCGACCGACGACGACGAAGACGACGCCCAGGACGGCACGGAAGACGTAGCGGCGG
Personal tools