Template:SBB10 ConstructionFiles AndrewS sbb12

From OpenWetWare

Jump to: navigation, search
1) sbb12: Sleeping Beauty 3'TR
----------------------------------------------------------
Pool AS001-F through AS008-R, assemble by PCA
PCR AS001-F/AS008-R on PCA reaction	(259 bp, EcoRI/BamHI)
Substitute in pBjk2741-Bca1144	(EcoRI/BamHI, 910+2170, L)
Product is pBjk2741-sbb12
----------------------------------------------------------
AS001-F  PCA Assembly of sbb12 CCATAGAATTCATGAGATCTTTGAGTGTATGTTAACTTCTGACCCACTGG
AS002-R  PCA Assembly of sbb12	ATTTCAGCTTTTATTTCTTTCATCACATTCCCAGTGGGTCAGAAGTTAAC
AS003-F  PCA Assembly of sbb12	AAAGAAATAAAAGCTGAAATGAATCATTCTCTCTACTATTATTCTGATAT
AS004-R  PCA Assembly of sbb12	AGGATCACCACTTTATTTTAAGAATGTGAAATATCAGAATAATAGTAGAG
AS005-F  PCA Assembly of sbb12	TAAAATAAAGTGGTGATCCTAACTGACCTTAAGACAGGGAATCTTTACTC
AS006-R  PCA Assembly of sbb12 CACTTTTTCACAATTCCTGACATTTAATCCGAGTAAAGATTCCCTGTCTT
AS007-F  PCA Assembly of sbb12	TCAGGAATTGTGAAAAAGTGAGTTTAATGTATTTGGCTAAGGTGTATGTA
AS008-R  PCA Assembly of sbb12	CTGATGGATCCCAGTTGAAGTCGGAAGTTTACATACACCTTAGCCAAAT

JCA Notes

  • correct
  • Need to put parts in clotho
Personal tools