Template:SBB10Project-29071
Welcome to your project page!
For each part listed, you should:
- Design oligos to make your part
- Write up proper construction files and put it on the Construction Files page
- Put your oligos on the Oligo Log page
- Put your parts into Clotho
You should design your construction strategy to put your part into plasmid vectorName-Bca1144 (Where vectorName is indicated for each part) using EcoRI and BamHI or just BamHI or BglII for EIPCR. The maps for all plasmids involved in our project can be downloaded here.
Several references have been provided to give you some background on the biology of your part.
Also, use the link above left to upload a picture of yourself, your name, and anything else you'd like.
Finally, you should create a notebook on the main page of the wiki
sbb29: O99 rep Protein
Source: pEC52 Target Sequence: cctggaaggaatcgtaacacatgagcgccgcgcttcaatacttcgaagaaaatttaccccaccgtccctatcacacggatgatctcgcttttggtcttcgcatctccggcaaagggcgtgcgcttcttgcggggtacatccagcagaaccagcctcatgcgcagttctggctggtttttgacgttgaccgcgagggggctgcgattgactggagcgaccggaacgcccccgcgccgaacatcaccgtaaaaaatcccgtgaacggtcatgctcacctgctctatgcactcaacatcgccgtgagaaccgcgcctgatgcgtcggttaaggcactgaagtacgctgccgcgatagagcgtgcgctgtgtgagaaacttggtgcagatgtgaactacagcggactgatttgcaaaaatccgttccacctggaatggctggtgatggagtggcgcgaggaagcctataccctcgatgaactggctgattatctcgatttgagcgcctcagcgcgccgtagcatcgataaacattacgggatggggcgaaactgccacctgttcgaaatgacgcgcaaatgggcttacagggcgattcgtcagggctggcctgtattctcacaatggcttgatgccgtgatccagcgtgtcgaaatgtacaacgtatcgcttcccgttccgctttctccggcggaatgtcgggctattggcaagagcattgcgaaatacacgcacaggaacttcacgccggaaactttcgcacagtatgtggctgatacgcacacgccagaaattcaggctgcacgtggtcgcaagggcgggaaaattggaggtgctaagtctaagcgtggtgctgttgccacatctgcgcgaacgttgaaaccgtgggagactcttggaattagccgcgcctggtattaccaactgaaaaaacgaggtcttgtagagtag Vector: pBca9523 Short description: rbs_repO99! Genbank reference: D30060.1 Flavor: {rbs.part!} Family: Replication protein
This part encodes a replication protein
Replication proteins are, well, proteins involved in replication. Most of the ones involved in this project are DNA binding proteins of sorts that bind to a specific DNA cis element and initiate replication in cis. In other words, they replicate the DNA that contains the cis element.
Different replication protein coding parts are needed in different flavors, so take special note of what type this one should be. Replication proteins are often toxic to E. coli, so you may have some difficulty making this part. Make careful note in your notebook about the size distribution of colonies you get on your plates and the ratio of red to white colonies.
This part is associated with colE2 orthogonal replicon devices
The colE2 family of replicons encode two elements to enable replication of a circular DNA in E. coli: one is a protein called Rep and the other is a cis element, or more specifically the origin of replication, or just ori. Placing the ori in cis and a complete gene for producing Rep either in cis or in trans should allow replication of the DNA containing ori.
The purpose for these devices is to make additional conditional replicons that can be used in the same cell in E. coli. Ultimately, these will drive replication of the delivered DNAs in our systems allowing them to be cranked up to really high-copy in the cell. Our "Entry Vector" for this project, pBjk274, incidentally, replicates with a colE2-derived replicon. So, take special note of the instructions below as to which plasmid you should use for constructing your basic part.
You should read the following papers
References: PMID 17098894, PMID 8609624, and PMID 2841566.
sbb28: CA42 rep Gene
Source: pEC22-CA42 Target Sequence: cagctgaagtgaccggattagcaacgcagtaacccgaaatcctctttgacaaaaacaaagcgtgtcaggctgattctgatgcgcttttttttgaaatgtcacaaaaattccatgcgggagatgagagctaaaatccccgtgcagaactttccacccagggcgagaaaacttgtcattttgacctgttcgcccttcggaacagtcgaaatcgatcgcgcatcgctttcgtgcatagttatgcagccctctaaaaacgattctggcgcgtttttctggtttggcctggtgttttcttgtctttttgcgttttttgcgccagaaagcgactgaggggcgttttaaggggtacgtacaacgggagttatggtaaatggatcgggtttycgggaaggttcgacaggatttgccgttgggtgtagtgtaagcgactgaaaaacaaacgcccctgaaatcatgtccagatccggcaagattcaacatgaaatacagagggcgtgtaggtcgcataacccggagagaatcgtaacacatgagcgccgcgcttcaatacttcgacgaaaatttaccccatcgtccctatcacacggatgatctcgcttttggtcttcgcatctccggcaaagggcgtgcgcttcttgcgcggtacatacagcagaaccagcctcatgcgcagttctggctggtttttgatgttgaccgcgagggggctgcgattgactggagcgacctgaacgcccccgcaccgaacatcaccataaaaaatcccgtgaacggtcacgcccacctgctctacgcactcaatatcgccgtgagaaccgcgcctgatgcttcggttaaggcactgaaatacgccgccgcgattgaacgtgcgttgtgtgaaaaactgggcgcagatgtaaactacagcggcctgatttgcaaaaatccgttccatctggaatggcaggtgatggagtggcgtgaggaagcctataccctcgatgaactggctgattatcttgatttgagcacttcagcgcgccgtagcatcgataaacattacgggatggggcgaaactgccatctgttcgaaatgacgcgcaaatgggcttacagggcgattcgtcagggctggccagcattctcacagtggcttgatgccgtgattcagcgtgtcgaaatgtacaacgcatcgcttcccgttccgctttcacctcctgaatgtcgggctattggcaagagtattgcgaaatacacgcacaggaacttcacggcggaaactttcgcacagtatgtggctgatacgcacacgccagaaatacaggccaagagaggcaggaaaggtggcatcgctaaaggcgaagcctacgatgacaagcgtttcatggcgctatgtatgctggagaatggatattctcagaaagctattgcggcgatgttggaggtttctactcgaaccattcgaaactggaaaagcggaaaatag Vector: pBca9523 Short description: 5'UTR_repCA42! Genbank reference: D30056.1 Family: Expressed CDS
This part encodes a Promoter.CDS composite part
Sometimes we make basic parts contain more than just a primitive element if there is reason to believe that some natural non-biobrick composition might be important for its activity. This is one of those instances. The part encodes a native promoter, rbs, and coding sequence, but no terminator.
Parts containing transcriptionally-competent constructs are often toxic to E. coli, so you may have some difficulty making this part. Make careful note in your notebook about the size distribution of colonies you get on your plates and the ratio of red to white colonies.
This part is associated with colE2 orthogonal replicon devices
The colE2 family of replicons encode two elements to enable replication of a circular DNA in E. coli: one is a protein called Rep and the other is a cis element, or more specifically the origin of replication, or just ori. Placing the ori in cis and a complete gene for producing Rep either in cis or in trans should allow replication of the DNA containing ori.
The purpose for these devices is to make additional conditional replicons that can be used in the same cell in E. coli. Ultimately, these will drive replication of the delivered DNAs in our systems allowing them to be cranked up to really high-copy in the cell. Our "Entry Vector" for this project, pBjk274, incidentally, replicates with a colE2-derived replicon. So, take special note of the instructions below as to which plasmid you should use for constructing your basic part.
You should read the following papers
References: PMID 17098894, PMID 8609624, and PMID 2841566.
sbb42: Pre-Pro sequence
Source: pBjh1601AC-Bjh1723 Vector: pBjk2741 Short description: {rbs_pelB>} Family: Targeting Peptide
This part encodes a prepro sequence. The "pre" sequence targets secretion of a protein fused to it's C-terminus to the periplasm of E. coli. the "pro" part of the sequence allows the peptide to be clipped off by a protease releasing the protein to be a soluble protein in the periplasm. Note that this part is of the rbs.part> flavor, so it also encodes a ribosome binding site and start codon.
This part exists but requires an EcoRI/BamHI transfer
This part has already been made, but it's with the wrong vector for our assembly program. We need to move the part into a different plasmid. We'll do this with an EcoRI/BamHI transfer. The protocol describing this is here.