Search results
From OpenWetWare
Jump to navigationJump to search
- assess/compare the quality of your assembly? Here's one way, from Assemblathon 2010 Scaffolder Bambus 2 RAD the wiki Gene discovery and annotation Variant calling SAMtools...4 KB (0 words) - 23:41, 23 September 2017
- project. 3D bio-scaffold materials have many applications in tissue engineering and regenerative medicine. We hope to build up our bio-scaffold material pixel...4 KB (659 words) - 19:25, 8 September 2008
- 015 (part of scaffold): 5'- GTAAATTCAGAGACTGCGCTTTCC -3' 3' end (21 bp) of scaffold of strand 034: 5'- GATGTTATTACTAATCAAAGA -3' Scaffold-oligo-oligo-scaffold...17 KB (1,322 words) - 21:04, 10 August 2006
- disease. Repair is stimulated by insertion of a porous scaffold at the wound or disease site; the scaffold may carry relevant mature or progenitor cells, and...3 KB (336 words) - 18:47, 31 January 2011
- is typically stimulated by insertion of a porous scaffold at the wound or disease site; the scaffold may carry relevant mature or progenitor cells, and...2 KB (251 words) - 15:45, 29 January 2008
- disease. Repair is stimulated by insertion of a porous scaffold at the wound or disease site; the scaffold may carry relevant mature or progenitor cells, and...3 KB (331 words) - 21:01, 17 April 2013
- disease. Repair is stimulated by insertion of a porous scaffold at the wound or disease site; the scaffold may carry relevant mature or progenitor cells, and...3 KB (330 words) - 01:40, 29 January 2012
- popular vote: Bashor CJ, Helman NC, Yan S, and Lim WA. Using engineered scaffold interactions to reshape MAP kinase pathway signaling dynamics. Science...294 bytes (0 words) - 23:26, 4 September 2008
- disease. Repair is stimulated by insertion of a porous scaffold at the wound or disease site; the scaffold may carry relevant mature or progenitor cells, and...3 KB (338 words) - 21:42, 3 February 2014
- disease. Repair is stimulated by insertion of a porous scaffold at the wound or disease site; the scaffold may carry relevant mature or progenitor cells, and...3 KB (332 words) - 07:50, 2 February 2010
- disease. Repair is stimulated by insertion of a porous scaffold at the wound or disease site; the scaffold may carry relevant mature or progenitor cells, and...3 KB (332 words) - 01:51, 14 April 2009
- Design 2 Design 3 Design 4 Design 5 Design 6 Design 4 Overview Schematics Scaffold Code Latches Final Oligo List based on n = 0.324 nm, d = 3.0 nm Error creating...2 KB (44 words) - 14:36, 27 July 2006
- Design 2 Design 3 Design 4 Design 5 Design 6 Design 5 Overview Schematics Scaffold Code Latches Final Oligo List EM images The goal of this design is to create...2 KB (90 words) - 12:54, 7 August 2006
- annotating the Genome and working on a final assembly of the sequenced scaffolds. The Mimulus Genome can be accessed though Phytozome. Duke University is...2 KB (252 words) - 14:09, 16 November 2014
- remaining parts. The section alpha scaffold does not contain any known protein coding domains. We sent the scaffold sequence (1,334 bp) to Blue Heron Biotechnology...11 KB (1,272 words) - 03:36, 26 August 2005
- missing Design 5 double-ply hexagonal barrel (one scaffold), separate double-ply lids (second scaffold) Error creating thumbnail: File missing Design 6...3 KB (179 words) - 12:56, 7 August 2006
- T7.1/Specification (section Scaffolds)refactored regions to wild-type sequence. We used scaffolds to build sections alpha and beta. A scaffold is essentially the sequence that remains when all...7 KB (1,098 words) - 02:54, 28 April 2006
- developed highly programmable scaffold to induce the assembly of amphiphilic molecules. Because of the programmability of the scaffold, the size and shape of...3 KB (452 words) - 10:56, 13 September 2012
- Design 5 Overview Schematics Scaffold Code Latches Final Oligo List EM images Barrel Scaffold Lid 1 Scaffold Lid 2 Scaffold...2 KB (39 words) - 20:20, 2 August 2006
- known used as scaffold for the origami structure DNA single strand staples Designed with cadnano to form the structure together with the scaffold Two staples...5 KB (888 words) - 09:43, 26 October 2013