Search results

assess/compare the quality of your assembly? Here's one way, from Assemblathon 2010 Scaffolder Bambus 2 RAD the wiki Gene discovery and annotation Variant calling SAMtools...

project. 3D bio-scaffold materials have many applications in tissue engineering and regenerative medicine. We hope to build up our bio-scaffold material pixel...

015 (part of scaffold): 5'- GTAAATTCAGAGACTGCGCTTTCC -3' 3' end (21 bp) of scaffold of strand 034: 5'- GATGTTATTACTAATCAAAGA -3' Scaffold-oligo-oligo-scaffold...

disease. Repair is stimulated by insertion of a porous scaffold at the wound or disease site; the scaffold may carry relevant mature or progenitor cells, and...

is typically stimulated by insertion of a porous scaffold at the wound or disease site; the scaffold may carry relevant mature or progenitor cells, and...

disease. Repair is stimulated by insertion of a porous scaffold at the wound or disease site; the scaffold may carry relevant mature or progenitor cells, and...

disease. Repair is stimulated by insertion of a porous scaffold at the wound or disease site; the scaffold may carry relevant mature or progenitor cells, and...

popular vote: Bashor CJ, Helman NC, Yan S, and Lim WA. Using engineered scaffold interactions to reshape MAP kinase pathway signaling dynamics. Science...

disease. Repair is stimulated by insertion of a porous scaffold at the wound or disease site; the scaffold may carry relevant mature or progenitor cells, and...

disease. Repair is stimulated by insertion of a porous scaffold at the wound or disease site; the scaffold may carry relevant mature or progenitor cells, and...

disease. Repair is stimulated by insertion of a porous scaffold at the wound or disease site; the scaffold may carry relevant mature or progenitor cells, and...

Design 2 Design 3 Design 4 Design 5 Design 6 Design 4 Overview Schematics Scaffold Code Latches Final Oligo List based on n = 0.324 nm, d = 3.0 nm Error creating...

Design 2 Design 3 Design 4 Design 5 Design 6 Design 5 Overview Schematics Scaffold Code Latches Final Oligo List EM images The goal of this design is to create...

annotating the Genome and working on a final assembly of the sequenced scaffolds. The Mimulus Genome can be accessed though Phytozome. Duke University is...

remaining parts. The section alpha scaffold does not contain any known protein coding domains. We sent the scaffold sequence (1,334 bp) to Blue Heron Biotechnology...

missing Design 5 double-ply hexagonal barrel (one scaffold), separate double-ply lids (second scaffold) Error creating thumbnail: File missing Design 6...

refactored regions to wild-type sequence. We used scaffolds to build sections alpha and beta. A scaffold is essentially the sequence that remains when all...

developed highly programmable scaffold to induce the assembly of amphiphilic molecules. Because of the programmability of the scaffold, the size and shape of...

Design 5 Overview Schematics Scaffold Code Latches Final Oligo List EM images Barrel Scaffold Lid 1 Scaffold Lid 2 Scaffold...

known used as scaffold for the origami structure DNA single strand staples Designed with cadnano to form the structure together with the scaffold Two staples...