Search results

remaining parts. The section alpha scaffold does not contain any known protein coding domains. We sent the scaffold sequence (1,334 bp) to Blue Heron Biotechnology...

refactored regions to wild-type sequence. We used scaffolds to build sections alpha and beta. A scaffold is essentially the sequence that remains when all...

assess/compare the quality of your assembly? Here's one way, from Assemblathon 2010 Scaffolder Bambus 2 RAD the wiki Gene discovery and annotation Variant calling SAMtools...

exception of the Insert which comes as part of the scaffold). This sequence is the vector scaffold. It has BBa_P1016 (ccdB, a toxic gene ... note that...

015 (part of scaffold): 5'- GTAAATTCAGAGACTGCGCTTTCC -3' 3' end (21 bp) of scaffold of strand 034: 5'- GATGTTATTACTAATCAAAGA -3' Scaffold-oligo-oligo-scaffold...

annotating the Genome and working on a final assembly of the sequenced scaffolds. The Mimulus Genome can be accessed though Phytozome. Duke University is...

multiplex genome engineering and accelerated evolution Synthetic protein scaffolds provide modular control over metabolic flux Engineering the Salmonella...

4.5 μL p7308 scaffold (44 nM) 2 μL oligos (990 nM) 2 μL 10x folding buffer (500 mM HEPES pH 7.5, 500 mM NaCl, 100 mM MgCl2) 11.5 μL dH2O 4.5 μL p7308 scaffold...

DNA fragments that need to be synthesized. This sequence is the vector scaffold. It has BBa_P1011 (ccdB, a toxic gene) and BBa_I50020 (pUC19 origin) in...

placed into two systems. Protein based scaffolds and polysaccharide based scaffolds [16]. Protein based scaffolds are created by molecules composed of amino...

in particular designing in multiple orthogonal functions onto a single scaffold, the group also devotes a great deal of it's effort toward the creation...

Design 2 Design 3 Design 4 Design 5 Design 6 Design 4 Overview Schematics Scaffold Code Latches Final Oligo List The code is fairly general with the exception...

Design 2 Design 3 Design 4 Design 5 Design 6 Design 4 Overview Schematics Scaffold Code Latches Final Oligo List Monday, 2006 July 10 Lid 1: 1344 AATGCTA...

1-ply lids Design 5 double-ply hexagonal barrel (one scaffold), separate double-ply lids (second scaffold) Design 6 double-ply hexagonal barrel, no lids Earlier...

assembled with an antibiotic resistance marker and cloned into the vector scaffold to generate a new single copy BioBricks plasmid. Chris Anderson suggested...

proteins would not be a very relevant chassis response. The GFP and Mcherry scaffolds I'm using were constructed by Heather Keller of the Endy Lab. They include...

concentration) influence efficiency. Membrane bound protein, lipid raft, protein scaffold, and protein charge influence yield. Total cellular protein is lineage...

Design 2 Design 3 Design 4 Design 5 Design 6 Design 5 Overview Schematics Scaffold Code Latches Final Oligo List EM images The goal of this design is to create...

Design 2 Design 3 Design 4 Design 5 Design 6 Design 4 Overview Schematics Scaffold Code Latches Final Oligo List Lid 1: 000 002 004 006 008 010 012 ... 001...

The vector scaffold took 5 months. The resistance markers and pSC101 replication origin were synthesized as ordered. The vector scaffold had some mutations...