Search results
From OpenWetWare
Jump to navigationJump to search
- or more. DUE Tue 29-Sep: Familiarize yourself with OMIM, GeneTests, and SNPedia and note on your talk page at least one big concept for Human2.0 and at...3 KB (421 words) - 17:51, 12 October 2009
- /home/trait/core/snpedia.py - Outputs tab-separated variant information (into data/snpedia.txt) for each entry in SNPedia /home/trait/core/snpedia_print_genotypes...13 KB (2,048 words) - 04:08, 11 December 2009
- thus allows scientists to get credit for - every contribution that's made. SNPedia shares information about the effects of variations in your DNA, citing peer-reviewed...6 KB (756 words) - 00:12, 18 September 2013
- People Publications Courses Contact SNPedia Gene World by Erik Corona Cell Biology by the Numbers YouTube Channel Case...2 KB (235 words) - 20:52, 17 January 2019
- in the BSN gene, rs17234657, rs1000113, rs10761659 and many more.- www.snpedia.com Primer Design Rs11805303: Sequences: TGCTTGCAAACAGAGAACTGTTTCCT[C]A...8 KB (0 words) - 00:06, 11 December 2012
- 5x increased risk of Alzheimer’s and decreased age at onset (http://www.snpedia.com/index.php/Rs4934(A;A). There was no information pertaining to Rs4934...12 KB (0 words) - 17:41, 29 November 2012
- ability). A starting point for this kind of work is to cross-reference the SNPedia, which catalogs easily/cheaply-testable human SNPs associated with some...34 KB (5,326 words) - 15:41, 18 December 2009
