Search results

From OpenWetWare
Jump to navigationJump to search
Did you mean: alex seq
  • (preferred) others: SeqMap, Eland Features: "Support for arbitrarily long uneven read lengths" http://www.alexaplatform.org/alexa_seq/downloads.htm Malachi...
    12 KB (1,677 words) - 09:50, 30 September 2014
  • terminator. Primers for the gene 399881 - 40119 OLIGO start len tm gc% any 3' seq LEFT PRIMER 132 20 59.41 40.00 8.00 0.00 TGAATGCCGGGATTAGTTTT RIGHT PRIMER...
    6 KB (914 words) - 03:42, 18 November 2007