SEED/2010/Day 4

From OpenWetWare

Jump to: navigation, search

Contents

Morning

  • Set up 50ul PCRs with 2 different forward RBS primers
    • 5ul 10x NovaTaq Buffer with MgCl2
    • 1ul dNTP mix (10mM each dNTP)
    • 1ul reverse primer (VR)
    • 1ul RBS specific forward primer
    • 0.25ul NovaTaq DNA polymerase
    • 0.5ul DNA template of E0050 (10ng)
    • rest PCR grade water
  • Cycle 30 times
    • 30s@94C
    • 30s@55C
    • 1m@72C
  • Pour gel

Afternoon

  • Run plasmid digest and PCRs on gel
  • Cut out bands and save in freezer

Lecture

  • Review units
    • Volume (L)
    • Mass (g)
    • Moles (mol)
    • Molecular weight (Da)
    • Concentration
      •  % w/v (e.g. 1% agarose)
      •  % v/v (e.g. 70% ethanol)
      • mass/volume (e.g. ng/ul)
      • molarity (e.g. 1M NaCl)
      • factors (e.g. 10x buffer)
  • Prefixes (milli, micro, nano, pico)
  • PCR discussion
  • What is Synthetic Biology?
    • Tie in Comic
    • General, Very High Level Methods (Standardization, Abstraction, Encapsulation)
    • General hierarchy (Parts, Devices, Systems)
    • Rational Design from Ground Up
  • Why should we care?
    • Project Ideas Homework Discussion
    • Environment, Energy, Medicine, Materials, Chemicals, Computing
    • Understanding of Regulation, Function, Design (Minimal systems)

Instructor Preparation

  • Oligos
    • VR: attaccgcctttgagtgagc
    • B0030.E0040-F: gaattctctagagattaaagaggagaaatactagatgcgtaaaggagaagaacttttc
    • B0031.E0040-F: gaattctctagagtcacacaggaaacctactagatgcgtaaaggagaagaacttttc
    • B0032.E0040-F: gaattctctagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttc
    • B0033.E0040-F: gaattctctagagtcacacaggactactagatgcgtaaaggagaagaacttttc
    • B0034.E0040-F: gaattctctagagaaagaggagaaatactagatgcgtaaaggagaagaacttttc
    • B0035.E0040-F: gaattctctagagattaaagaggagaatactagatgcgtaaaggagaagaacttttc
  • Pairs of RBS primers to assign to groups (selected based on estimated strength):
    • B0030 & B0032
    • B0031 & B0035
    • B0033 & B0034
    • B0032 & B0033
    • B0031 & B0034
    • B0030 & B0035
Personal tools