SEED/2010/Day 4
From OpenWetWare
Jump to navigationJump to search
Morning
- Set up 50ul PCRs with 2 different forward RBS primers
- 5ul 10x NovaTaq Buffer with MgCl2
- 1ul dNTP mix (10mM each dNTP)
- 1ul reverse primer (VR)
- 1ul RBS specific forward primer
- 0.25ul NovaTaq DNA polymerase
- 0.5ul DNA template of E0050 (10ng)
- rest PCR grade water
- Cycle 30 times
- 30s@94C
- 30s@55C
- 1m@72C
- Pour gel
Afternoon
- Run plasmid digest and PCRs on gel
- Cut out bands and save in freezer
Lecture
- Review units
- Volume (L)
- Mass (g)
- Moles (mol)
- Molecular weight (Da)
- Concentration
- % w/v (e.g. 1% agarose)
- % v/v (e.g. 70% ethanol)
- mass/volume (e.g. ng/ul)
- molarity (e.g. 1M NaCl)
- factors (e.g. 10x buffer)
- Prefixes (milli, micro, nano, pico)
- PCR discussion
- What is Synthetic Biology?
- Tie in Comic
- General, Very High Level Methods (Standardization, Abstraction, Encapsulation)
- General hierarchy (Parts, Devices, Systems)
- Rational Design from Ground Up
- Why should we care?
- Project Ideas Homework Discussion
- Environment, Energy, Medicine, Materials, Chemicals, Computing
- Understanding of Regulation, Function, Design (Minimal systems)
Instructor Preparation
- Oligos
- VR: attaccgcctttgagtgagc
- B0030.E0040-F: gaattctctagagattaaagaggagaaatactagatgcgtaaaggagaagaacttttc
- B0031.E0040-F: gaattctctagagtcacacaggaaacctactagatgcgtaaaggagaagaacttttc
- B0032.E0040-F: gaattctctagagtcacacaggaaagtactagatgcgtaaaggagaagaacttttc
- B0033.E0040-F: gaattctctagagtcacacaggactactagatgcgtaaaggagaagaacttttc
- B0034.E0040-F: gaattctctagagaaagaggagaaatactagatgcgtaaaggagaagaacttttc
- B0035.E0040-F: gaattctctagagattaaagaggagaatactagatgcgtaaaggagaagaacttttc
- Pairs of RBS primers to assign to groups (selected based on estimated strength):
- B0030 & B0032
- B0031 & B0035
- B0033 & B0034
- B0032 & B0033
- B0031 & B0034
- B0030 & B0035