SBB10Ntbk-DanielSedor
From OpenWetWare
Contents |
Construction Files
sbb10: Sleeping beauty (SB100x)
Construction of sbb10
PCR DS001/CA1600 on Bca1587 5-1 (420bp, gp=A)
PCR CA1597/DS002 on Bca1587 5-6 (767bp, gp=B)
----------------------------
PCR DS001 and DS002 on A+B (1051 bp, EcoRI/BamHI)
Sub into pBjk2741 (EcoRI/BamHI, 2170+910, L)
Product is pBjk2741-sb10 {<SB100x!}
----------------------------
DS001 Forward oligo for cloning of <SB100x!
CCATAgaattcATGagatctGGTAAATCTAAAGAAATCTCTCAGGAC
CA1600 CGAAACGCAGACGAGCTTTTTTGTGACGGTTCTGGAGCAGCGGTTTTTT
PCA assembly of sleepingBeauty (Bca1587)
CA1597 ATGCTGGAAGAAACCGGTACCAAAGTTTCTATCTCTACCGTTAAACGTG
PCA assembly of sleepingBeauty (Bca1587)
DS002 Reverse oligo for cloning of <SB100x!
ctgatGGATCCttaGTATTTGGTAGCGTTACCTT
Part:
gatctGGTAAATCTAAAGAAATCTCTCAGGACCTGCGTAAACGTATCGTTGACCTGCACAAATCTGGTTCTTCTCTGGGTGCTATCTCTAAACGTCTGGCTGTTCCGCGTTCTTCTGTTCAGACCATCGTTCGTAAATACAAACA
CCACGGTACCACCCAGCCGTCTTACCGTTCTGGTCGTCGTCGTGTTCTGTCTCCGCGTGACGAACGTACCCTGGTTCGTAAAGTTCAGATCAACCCGCGTACCACCGCTAAAGACCTGGTTAAAATGCTGGAAGAAACCGGTACC
AAAGTTTCTATCTCTACCGTTAAACGTGTTCTGTACCGTCACAACCTGAAAGGTCACTCTGCTCGTAAAAAACCGCTGCTCCAGAACCGTCACAAAAAAGCTCGTCTGCGTTTCGCTACCGCTCACGGTGACAAAGACCGTACCT
TCTGGCGTAACGTTCTGTGGTCTGACGAAACCAAAATCGAACTGTTCGGTCACAACGACCACCGTTACGTTTGGCGTAAAAAAGGTGAAGCTTGCAAACCGAAAAACACCATCCCGACCGTTAAACACGGTGGTGGTTCTATCAT
GCTGTGGGGTTGCTTCGCTGCTGGTGGTACCGGTGCTCTGCACAAAATCGACGGTATCATGGACGCTGTTCAGTACGTTGACATCCTGAAACAGCACCTGAAAACCTCTGTTCGTAAACTGAAACTGGGTCGTAAATGGGTTTTC
CAGCACGACAACGACCCGAAACACACCTCTAAAGTTGTTGCTAAATGGCTGAAAGACAACAAAGTTAAAGTTCTGGAATGGCCGTCTCAGTCTCCGGACCTGAACCCGATCGAAAACCTGTGGGCTGAACTGAAAAAACGTGTTC
GTGCTCGTCGTCCGACCAACCTGACCCAGCTGCACCAGCTGTGCCAGGAAGAATGGGCTAAAATCCACCCGACCTACTGCGAAAAACTGGTTGAAGGTTACCCGAAACGTCTGACCCAGGTTAAACAGTTCAAAGGTAACGCTAC
CAAATACTAAG
sbb39: Magnesium-repressed Promoter
Eco/Bam transfer pBjh1601CK-Bjh1380
Sub into pBjk2741-Bca1144 (EcoRI/BamHI, 910+2170, L)
Product is pBjk2741-Bjh1380 {PmgtCB}
sbb10: Nuclear Localization Peptide
Eco/Bam transfer pBjh1601CK-Bjh1858
Sub into pBjk2741-Bca1144 (EcoRI/BamHI, 910+2170, L)
Product is pBjk2741-Bjh1858 {<NIS!}
Lab Notes
17 February 2010
Prepared two PCR's according to the Cloning by PCR protocol using oligos DS001/CA1600 (gp=A) and DS002/CA1597 (gp=B) from the sbb10 construction file.
Submitted preparation for thermocycling.
22 February 2010
Mixed 6μL of PCR products sbb10A and sbb10B (2/17 versions) with 4μL of Loading Buffer for the purposes of running a preparative gel (see SOEing by PCR protocol for more details). Preparative gel results (which can be found here) did not agree with the predictions made in the construction file.
Prepared two new PCR's according to the Cloning by PCR protocol.
24 February 2010
Mixed 6μL of PCR products sbb10A and sbb10B (2/22 versions) with 4μL of Loading Buffer for the purposes of running a preparative gel (see SOEing by PCR protocol for more details). Preparative gel results (which can be found here) were in agreement with the predictions made in the sbb10 construction file for the gp=A and gp=B reactions. Performed the Zymo Gel Purification protocol on sbb10A and sbb10B in the same zymo column.
1 March 2010
Performed SOEing PCR protocol using sbb10A+sbb10B as a template and DS001 and DS002 as oligos.
8 March 2010
Purified the DNA from the 3/1 PCR reaction in accordance with the Regular Zymo Cleanup protocol.
10 March 2010
Eco/Bam digest on sbb10. Preparative gel. Eco/Bam transfer on sbb39. Eco/Bam transfer on sbb40.


