RobWardenWNB:M3D1

From OpenWetWare

Jump to: navigation, search

Contents

Expression Engineering, Day 1, 4/4/07

Choosing a SAGA Subunit

Purpose To choose a SAGA gene that when deleted will produce viable phage with an interesting phenotype.

Notes on Genes:

Protein Function Notes
Ada1 Structural, Activator of histone acetyltransferase, Acetylation & Transciption Regulation
Ada2 Activator of histone acetyltransferase
Ada3 Glucose Regulator, histone acetyltransferase
Gcn5 histone acetyltransferase
Ada5 SAGA Integrity, Transcriptional regulator
Spt3 Transcription Activator (of RNAP2-dependant promoters) and Inhibitor
Spt7 SAGA Assembly, C-Truncation in SALSA
Spt8 required for SAGA-mediated inhibition at some promoters
Spt20 SAGA Integrity
Sgf73 Formation of preinitiation complex
Sgf29 Probably in SAGA
Sgf11 required for the Ubp8p association with SAGA and for H2B deubiquitylation
Ubp8 required for SAGA-mediated deubiquitination of histone H2B
Sus1 mRNA transport

Decision

We are going to delete Spt8 in the context of the following genome:
FY569: "a" ura3-52 leu2d1 spt7-223 his4-917d lys2-173R2
This will create the SALSA complex!

Primer Design

Forward Primer

  • Landing Sequence (first 20 bases of URA3): ATGTCGAAAGCTACATATAA
    • Tm = 54 C
    • Ta = 49 C
    • GC Ratio: 30%
    • There is also a large hairpin
  • Tail Sequence: ACTAAAGGCTCAGTTTTTTTTTTTTTCTTCTTTTACGTA
  • Complete Oligo: ACTAAAGGCTCAGTTTTTTTTTTTTTCTTCTTTTACGTAATGTCGAAAGCTACATATAA
    • Tm = 78.1 C
    • GC Ratio: 27.1%
    • Retains hairpin from landing sequence

Reverse Primer

  • Landing Sequence: Top - 5'-TGCGGCCAGCAAAACTAA-3' Reverse Compliment - 5'-TTAGTTTTGCTGGCCGCA-3'
    • Tm = 52.2 C
    • Ta = 47.2
    • GC Ratio: 50%
  • Tail Sequence: Reverse Compliment: TATGATTATGATTATGGTTATGATTATTATTACAACTCA
  • Complete Oligo: TATGATTATGATTATGGTTATGATTATTATTACAACTCATTAGTTTTGCTGGCCGCA
    • Tm = 78.5 C
    • Tm = 73.5 C
    • GC Ratio: 29.8%

PCR

PCR Mixture:

Template       		1 ul pRS406 (=100 ng)
Forward Primer 		1 ul (=100 pmol)
Reverse Primer 		1 ul (=100 pmol)
PCR Master Mix*		20 ul of 2.5X stock (see REAGENTS LIST)
H2O            		27 ul

Protocol:

  1. Add water to a PCR tube. Add 28 ul to another tube.
  2. Add primers
  3. Add template to first tube
  4. Add PCR Mix and pipette up and down
  5. Place in thermal cycler to undergo:
    • 95° 4 minutes
    • 95° 1 minute
    • 40° 1 minute
    • 72° 3 minute
    • repeat steps 2-4 5 times
    • 95° 1 minute
    • 45° 1 minute
    • 72° 3 minute
    • repeat steps 6-8 5 times
    • 95° 1 minute
    • 50° 1 minute
    • 72° 3 minute
    • repeat steps 10-12 30 times
    • 72° 10 minutes
    • 4° forever (or until one of the teaching faculty removes the reactions and stores them in the freezer)
Personal tools