Pig-tailing to reduce stutter

Return to Texas Switchgrass Collaborative

Pig-tailing is a technique of adding a few extra nucleotides to the 5' end of a reverse primer in order to prevent stuttering of microsatellite and other length polymorphism markers.

There are two options for Pig tailing that I know of, but I am not sure why to use one over the other:

PigA: GTTTCTT

PigB: GTTT

Make sure to attach them onto the 5' end of whichever primer you are "tailing." Make sure this is not the primer with a fluorescent or M13 label on it.

Here is an example of a reverse primer with PigA attached to it:

GTTTCTTGATCGCGCTCCTCTAATGTC