Mesoplasma florum: Tn5 Transposase

From OpenWetWare

Jump to: navigation, search

Contents

Tn5 Transposase production

Tn5 transposase is the key enzyme in forming transposomes for random transposon insertions. It is sold by Epicentre at ridiculously high price. Here, we make it from a plasmid provided by Prof. Wolfgang Hillen PMID 16820464. The protocol also builds on the NEB IMPACT-CN protein purification kit.

Materials

  • pWH1891 plasmid (kind gift of Prof. Wolfgang Hillen)
  • BL21(DE3)pLysS cells
  • TEGX buffer
    • 10 mM Tris-HCl pH 7.5
    • 700 mM NaCl
    • 1 mM EDTA
    • 10% glycerol
    • 0.1% Triton X-100


  • Storage buffer (Epicentre)
    • 50% glycerol
    • 50 mM Tris-HCl pH 7.5
    • 100 mM NaCl
    • 0.1 mM EDTA -- our version has 5 mM EDTA, since we never want in-vitro action
    • 1 mM DTT

Protocol

  • Grow BL21(DE3)pLysS cells transformed with pWH1891 in 10 ml culture.
  • Inoculate 2 liters of LB/Cm/Amp culture medium with the culture and grow overnight at 23°C
  • Induce cultures at OD 0.5 with 50 mM IPTG and grow an additional 5 hours
  • Spin down cultures and resuspend in 50 ml TEGX buffer/original liter, transferring to 50 ml centrifuge tubes
  • Spin down a second time and resuspend in 10 ml/original liter TEGX + Roche Complete protease inhibitor
  • Sonicate 3x pausing 10 minutes between sonications with the cells on ice
  • Centrifuge to remove cell debris
  • Load a 2 cm diameter column with 20 ml chitin bead suspension (10 ml beads)
  • Wash the column with 100 ml TEGX buffer
  • Load the cell supernatent onto the column and allow it to flow through
  • Flow the supernatent past the column a second time
  • Wash the column with 200 ml TEGX buffer
  • Add 1 ml of 1M IPTG to 20 ml of TEGX buffer
  • Flow the 20 ml IPTG + TEGX into the column
  • Cap the column and hold at 4°C overnight
  • Recover the protein with 10 ml TEGX buffer flowed through the column
  • Concentrate the protein by spinning in Centricon YM10
  • Dilute concentrate with 40% glycerol to bring final to 50%
  • Store aliquots at -80 and -20
  • Dilute to final 100 ng/ul (1.8 pmol/ul) with storage buffer for use

Molarity

  • Gel runs at 55 KD, approximately correct for a 450 AA protein.
  • Kostner06 uses 100-500 fmol DNA + 5x excess protein, or .5 - 2.5 pmol
  • 1 pmol protein = 55000 g/mol * 1e-12 mol = 55 ng
  • 1 pmol transposon = 2700 * 660 * 1e-12 = 1.8 ug
  • 100 fmol transposon = 180 ng

DNA binding tests

  • Use constant 200 ng of DNA (dilute from 1 ug/ul stock)
  • Use serial dilutions of protein starting at 8 ug/ul
    • 2x dilutions 0, 2, 1, 500, 250, 125, 62.5, 31.25, 15.6, 0 into 20ul TEGX + 200 ng/ul transposon DNA
  • Incubate 30 minutes at 37
  • Run on 0.8% E-Gel
  • DNA mixture 10*200 ng = 2 ug DNA = 2 ul DNA into 200 ul TEGX


  • Tests 3/24
    • 2 ul 116 ng/ul ME0 PCR DNA
    • 500 ng, 250, 125, 62.5, 31 ng Tpase in 20 ul final volume of storage buffer
    • incubate 1 hour 37C
    • overnight at 4C

Gel images, Goryshin00

  • Fig 1, 1.8 Kb transposon reacted at 2.5 ng/ul (total 1 ug) with Tn5 transposase at 10 ng/ul (total 4 ug) in 400 ul final volume, 1 hour at 37C
    • this is about 1 pmol of DNA and 72 pmol transposase, or a 72x molar excess of transposase
    • Concentrated to 20 ul and run on a 1.2% gel
  • 3.7 Kb transposon reacted at 50 ng/ul (2 ug total) with Tn5 transposase at 10 ng/ul (400 ng total) in 40 ul volume, 1 hour at 37C
    • this is 1 pmol DNA and 7.2 pmol transposase, for a 3x molar excess

Goryshin98 DNA binding and cutting tests

  • 0 to 3.8 pmol (nominal 2 ul of transposase, or 200 ng) of Tn5 transposase added to 0.26 pmol (nominal 1 ug of 5700 bp plasmid) plasmid in 20 ul volume
    • done with a buffer of 100 mM potassium glutamate, 25 mM Tris-acetate pH 7.5, 10 mM Mg-acetate, 50 ug/ml BSA, 0.5 mM b-mercaptoethanol, 2 mM spermidine, 10 ug/ml tRNA
    • incubated 1 hour at 20C, diluted 2-3x and incubated a further 4 hours at 37C (nominally to dilute CHAPS in transposase storage buffer)
    • results: near linear increase of cut out fragments with transposase molar excess of 0-9x

Standard Epicentre reaction

  • 1 ul DNA (100 ng/ul) in TE
  • 2 ul transposase
  • 1 ul glycerol
  • This is:
    • about 100 fmol or less transposon DNA
    • at 100 ng/ul, this is 3.8 pmol transposase or 38x molar excess
    • 25 ng/ul final, so expect 1e4 or so transformants

To Do

  • Prep new Tn5 protein (on hold, unnecessary)
  • quantitate existing stock with BSA dilution and gel (done, spec readings approximately correct)
  • Make storage buffer, dilute existing stock into storage buffer (done)
  • run Goryshin00 style test of transposome formation (to do; initial gel unconvincing)
  • Run Goryshin98 style test of transposon cutting (to do)
  • Try transforming E. coli cells (done, this is what counts, compared to Epicentre enzyme is OK)

pWH1891 Sequence information

  • T7 and Intein-R primers, ATG start at 45
  • Truncates aa's 1-4 from canonical sequence
  • Mutations
    • E54K -- improve binding to OE
    • M56A -- eliminate start for C-terminal inhibitory protein
    • L372P -- hyperactive mutation

>pWH1891
CCCTCTAGAATAATTTTGTTTAACTTTAAGAAGGAGATATACATATGATAACTTCTGCTCTTCATCGTGCGGCCGACTGGGCTAAATCTGTGTTCTCTTC GGCGGCGCTGGGTGATCCTCGCCGTACTGCCCGCTTGGTTAACGTCGCCGCCCAATTGGCAAAATATTCTGGTAAATCAATAACCATCTCATCAGAGGGT AGTAAAGCCGCCCAGGAAGGCGCTTACCGATTTATCCGCAATCCCAACGTTTCTGCCGAGGCGATCAGAAAGGCTGGCGCCATGCAAACAGTCAAGTTGG CTCAGGAGTTTCCCGAACTGCTGGCCATTGAGGACACCACCTCTTTGAGTTATCGCCACCAGGTCGCCGAAGAGCTTGGCAAGCTGGGCTCTATTCAGGA TAAATCCCGCGGATGGTGGGTTCACTCCGTTCTCTTGCTCGAGGCCACCACATTCCGCACCGTAGGATTACTGCATCAGGAGTGGTGGATGCGCCCGGAT GACCCTGCCGATGCGGATGAAAAGGAGAGTGGCAAATGGCTGGCAGCGGCCGCAACTAGCCGGTTACGCATGGGCAGCATGATGAGCAACGTGATTGCGG TCTGTGACCGCGAAGCCGATATTCATGCTTATCTGCAGGACAAACTGGCGCATAACGAGCGCTTCGTGGTGCGCTCCAAGCACCCACGCAAGGACGTAGA GTCTGGGTTGTATCTGTACGACCATCTGAAGAACCAACCGGAGTTGGGTGGCTATCAGATCAGCATTCCGCAAAAGGGCGTGGTGGATAAACGCGGTAAA CGTAAAAATCGACCAGCCCGCAAGGCGAGCTTGAGCCTGCGCAGTGGGCGCATCACGCTAAAACAGGGGAATATCACGCTCAACGCGGTGCTGGCCGAGG AGATTAACCCGCCCAAGGGTGAGACCCCGTTGAAATGGTTGTTGCTGACCAGCGAACCGGTCGAGTCGCTAGCCCAAGCCTTGCGCGTCATCGACATTTA TACCCATCGCTGGCGGATCGAGGAGTTCCATAAGGCATGGAAAACCGGAGCAGGAGCCGAGAGGCAACGCATGGAGGAGCCGGATAATCTGGAGCGGATG GTCTCGATCCTCTCGTTTGTTGCGGTCAGGCTGTTACAGCTCAGAGAAAGCTTCACGCCGCCGCAAGCACTCAGGGCGCAAGGGCTGCTAAAGGAAGCGG AACACGTAGAAAGCCAGTCCGCAGAAACGGTGCTGACCCCGGATGAATGTCAGCTACTGGGCTATCTGGACAAGGGAAAACGCAAGCGCAAAGAGAAAGC AGGTAGCTTGCAGTGGGCTTACATGGCGATAGCTAGACTGGGCGGTTTTATGGACAGCAAGCGAACCGGAATTGCCAGCTGGGGCGCCCTCTGGGAAGGT TGGGAAGCCCTGCAAAGTAAACTGGATGGCTTTCTTGCCGCCAAGGATCTGATGGCGCAGGGGATCAAGATCGGGTGCTTTGCCAAGGGTACCAATGTTT
TAATGGCGGATGGGTCTATGA

Testing the transposase

  • Transform 50 μl of E. coli Top10 electrocompetent cells with:
    • Tn5 transposons (1 μl); plate out on Tet plates, count colonies
    • pUC19 positive control 10 pg/μl; plate out on amp plates
    • Electroporation at 2.5 KV in 2 mm gap cuvette
    • pUC19 colonies visible in six hours under the microscope
    • Tet resistant colonies are not visible at that time

Notes

  • Davies00 uses 100 mM hydroxylamine as a cleavage reagent instead of DTT

References

Personal tools