Koch Lab:Protocols/Sequences/pCP681 unzip 2002

From OpenWetWare

Jump to: navigation, search
Add to My Links

Notes

  • This is the sequence of the pCP681 unzipping construct from Koch et al. 2002 Biophys. J paper.
  • Steve Koch 13:06, 14 July 2009 (EDT): I hastily copied and pasted this sequence, so I'm not 100% sure it's the correct one.
  • It is the "unzipping part only," so only the sequence that one would want to simulate unzipping for (i.e., not the anchor or initial 9 bp of shearing)

Sequence

5' TACTATACTACATTAGAATTCAGACAGCGGAAGAGCGCCCAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGGCACGACAGGTTTCCCGACTGGAAAGCGGGCAGTGAGCGCAACGCAATTAATGTGAGTTAGCTCACTCATTAGGCACCCCAGGCTTTACACTTTATGCTTCCGGCTCGTATGTTGTGTGGAATTGTGAGCGGATAACAATTTCACACAGGAAACAGCTATGACCATGATTACGCCAAGCTCGAAATTAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCCACCGCGGTGGCGGCCGCTCTAGAACTAGCTAGCTAGTGGATCCCCCCTGGATCCAGGAATTCCAACGAATAACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCGATCACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCTCGGGAATTCCAACGAATAACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCGATCACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCTCGGGAATTCCAACGAATAACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCGATCACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCTCGGGAATTCCAACGAATAACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCGATCACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCTCGGGAATTCCAACGAATAACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCGATCACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCATCTTTAAACTCGAGACTAGACCATGGAACCGAGCCCTATGCTTCGCGACTCCAGTGATCGGACGAGAACCGGTGCATTCACCCTGGTATAGTCGACGTCTCTTGCTTGATGAAAGTTAAGCTATTTAAAGGGTCAGGGATGTTATGACGTGATCGGCTTATAAATCCCTTCAAGTTATGCTAGCTTGGTACGCGGGGGATCCACTAGTTCTAGCAGATCCCGATCGGGAATTCCAACGAATAACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCGATCACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCTCGGGAATTCCAACGAATAACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCGATCACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCTCGGGAATTCCAACGAATAACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCGATCACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCTCGGGAATTCCAACGAATAACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCGATCACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCTCGGGAATTCCAACGAATAACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCGATCACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCATCTTTAAACTCGAGACTAGACCATGGAACCGAGCCCTATGCTTCGCGACTCCAGTGATCGGACGAGAACCGGTGCATTCACCCTGGTATAGTCGACGTCTCTTGCTTGATGAAAGTTAAGCTATTTAAAGGGTCAGGGATGTTATGACGTGATCGGCTTATAAATCCCTTCAAGTTATGCTAGCTTGGTACGCGGGGGATCCACTAGTTCTAGCAGATCCCGATCGGGAATTCCAACGAATAACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCGATCACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCTCGGGAATTCCAACGAATAACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCGATCACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCTCGGGAATTCCAACGAATAACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCGATCACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCTCGGGAATTCCAACGAATAACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCGATCACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCTCGGGAATTCCAACGAATAACTTCCAGGGATTTATAAGCCGATGACGTCATAACATCCCTGACCCTTTAAATAGCTTAACTTTCATCAAGCAAGAGCCTACGACCATACCATGCTGAATATACCGGTTCTCGTCCGATCACCGAAGTCAAGCAGCATAGGGCTCGGTTAGTACTTGGATGGGAGACCGCCTGGGAATACCGAATTCCCCGAATCTTTAAACTCGAGATCTACGCGGGGCTGCAGGAATTCGATATCAAGCTGGCGACCTAGCGT 3'

Personal tools