Koch Lab:Protocols/Sequences/PCR Primers

From OpenWetWare

Jump to: navigation, search
Add to My Links

Our naming convention for plasmids is as follows:

plasmid name + forward or reverse primer + index of 5' match + label

For example, pRL574-R2008-bio is a primer that binds the reverse strand of pRL574, with it's 5' match at base 2008, and a biotin label (position of label not specified in name, but often it's at the 5' end).


Contents

Primers for Plasmid pRL574

Plasmid pRL574 is a plasmid out of the Landick lab that was developed for transcription studies. Because of their seminar work in single-molecule transcription studies, many other non-transcription-related single-molecule experiments evolved that use this plasmid. We have a bunch of PCR primers that work on this plasmid to create various sized segments.

Link to a specific protocol for pRL574 PCR


pRL574-F853 or pRL574-F853-dig

This is the primer "P1" Steve used in grad school

5' GTAAAACGACGGCCAGTGAATTC 3' 
23 nucleotides 

pRL574-F834 or pRL574-F834-dig

Redesigned to substitute for F853. Designed to pair with pRL574-R2044; apparently works well with both R2044 and R2088

5' TTTTCCCAGTCACGACGTTG 3'
20 nucleotides

Biopolymer calc predicted melting temperature: 59.4, mFold: 59.7 (50 mM NaCl, 10 uM oligo), no hairpins detected

pRL574-R2008 or pRL574-R2008-bio

This is the primer "P13" that Steve used in grad school

5' CACGTAAGGTTTCAGAGATATATGGG 3'
26 nucleotides

pRL574-R2044 or pRL574-R2044-bio

designed to pair with pRL574-F834, apparently works just as well with F-853 as R2008 does.

5' CTACCAGTGCGCTCAGACG 3'
 - or -
5'-bio-CTACCAGTGCGCTCAGACG 3'
19 nucleotides

Biopolymer calc predicted melting temperature: 58.0, mFold: 62.2, no hairpins detected

pRL574-R1985

Designed by Brandon beck for easier use during BstXI cutting (smaller fragment after cut)

5' GGGCCGTGATCCAGATCG 3' 

pRL574-R5263 and pRL574-R5263-bio

5'- GGAAACAGCTATGACCATGATTAC
 - or -
5'-bio-GGAAACAGCTATGACCATGATTAC
Personal tools