Kai Yuet/Notebook2

From OpenWetWare
Jump to navigationJump to search

Kai's Notebook (Langer Lab)

Protocols

Laboratory Notebook

February 1, 2007

ATM siRNA sequences derived from siDESIGN, which analyzes potential sequences from cDNA with eight additional criteria as elaborated in Rational siRNA Design for RNA Interference, Reynolds, A. et al. (2004), Nature Biotechnology 22, 326-330) and then performing a Nucleotide-Nucleotide BLAST (BLASTN) homology search of each to determine whether the target sequence has similarities in other genes:

siRNA Sequence          Score     Location     GC Content     Criterion
                                 (NM_000051)               1 2 3 4 5 6 7 8

GTACCATAGGTGCCATTAA       9       3015-3033      42.11%    + + + + +   + +
TGAAGTCCATTGCTAATCA       9       4188-4206      36.84%    + + + + + + + +
TGATAGAGCTACAGAACGA       8         436-454      42.11%    + + + + + + + +
TGATTGTAGCAACATACTA       8         802-820      31.58%    + + + + +   + +	
TCAGTGTGCGAGACAAGAA       8       1036-1054      47.37%    + + + + +   + + 	
TCTCAATCTTACACTACTA       8       1484-1502      31.58%    + + + +   + + + 	
CTGCGATTGTTAACATCAA       8       2795-2813      36.84%    + + + +   + + + 	
TGACCGTGGAGAAGTAGAA       8       2875-2893      47.37%    + + + + +   + + 	
CAATGGAAGATGATACTAA       8       2895-2813      31.58%    + + + + +   + +	

Rational siRNA Design for RNA Interference.


January 29, 2007

Ataxia Telangiectasia Mutated (ATM)

(Includes Complementation Groups A, C and D)

Reference Access. Entrez Gene summary:

The protein encoded by this gene belongs to the PI3/PI4-kinase family. This protein is an important cell cycle checkpoint kinase that phosphorylates; thus, it functions as a regulator of a wide variety of downstream proteins, including tumor suppressor proteins p53 and BRCA1, checkpoint kinase CHK2, checkpoint proteins RAD17 and RAD9, and DNA repair protein NBS1. This protein and the closely related kinase ATR are thought to be master controllers of cell cycle checkpoint signaling pathways that are required for cell response to DNA damage and for genome stability. Mutations in this gene are associated with ataxia telangiectasia, an autosomal recessive disorder. Two transcript variants encoding different isoforms have been found for this gene.


ATM siRNA sequences from Human siRNA Database/Entrez Probe:

siRNA Sequence         Transfection        siRNA Source            Location       
                                                                  (NM_000051)  

Intra-S-Phase Checkpoint Activation by Direct CDK2 Inhibition
Mol Cell Biol]. 2004 July; 24(14): 6268–6277.

TAGAGCTACAGAACGAAAG    Lipofectamine 2000  Chemically Synthesized  439-457
GAATGTGAACACCACCAAA    Lipofectamine 2000  Chemically Synthesized  2279-2297
CTACACAAATATTGAGGAT    Lipofectamine 2000  Chemically Synthesized  4105-4123
CTGTACTTCCATACTTGAT    Lipofectamine 2000  Chemically Synthesized  5904-5922

ATR Couples FANCD2 Monoubiquitination to the DNA-damage Response.
Genes Dev. 2004 August 15; 18(16): 1958–1963. 

AACATACTACTCAAAGACATT  Lipofectamine 2000  Chemically Synthesized  812-832

MSH2 and ATR Form a Signaling Module and Regulate Two Branches of the Damage Response...
Proc Natl Acad Sci U S A. 2003 December 23; 100(26): 15387–15392.

AAGCACCAGUCCAGUAUUGGC  Oligofectamine      Chemically Synthesized  2402-2422

ATR-Dependent Phosphorylation of DNA-Dependent Protein Kinase Catalytic Subunit...
Mol Cell Biol. 2006 Oct;26(20):7520-8.

UGGUGCUAUUUACGGAGCU    Oligofectamine      Chemically Synthesized  784-802

ATM-dependent CHK2 Activation Induced by Anticancer Agent, Irofulven.
J Biol Chem. 2004 Sep 17;279(38):39584-92.

CATCTAGATCGGCATTCAG    Oligofectamine      Chemically Synthesized  509-527

Intra-S-Phase Checkpoint Activation by Direct CDK2 Inhibition.
ATR Couples FANCD2 Monoubiquitination to the DNA-damage Response.
MSH2 and ATR Form a Signaling Module and Regulate Two Branches of the Damage Response to DNA Methylation.
ATR-Dependent Phosphorylation of DNA-Dependent Protein Kinase Catalytic Subunit in Response to UV-Induced Replication Stress.
ATM-dependent CHK2 Activation Induced by Anticancer Agent, Irofulven.


ATM Antibodies for Western Blotting: At Biocompare.


ATM Probe for Northern Blotting:

Atm Expression Patterns Suggest a Contribution from the Peripheral Nervous System to the Phenotype of Ataxia–Telangiectasia.
Neuroscience, Volume 86, Issue 4 , 18 June 1998, Pages 1045-1054.

Forward Primer: (Sal I) CTCGTCGACGTGATGACCTGAGACAAGATGCTGTC
Reverse Primer: (Not I) CATAAGAATGCGGCCGCGCCATCCACAATATCTCTGGTGAGTC

Insert corresponds to nucleotides 8540-9136 (597 bp) of the ATM gene.


Useful Links

RNA Interference (RNAi) Resource at Ambion.
RNA Interference (RNAi) Protocols at Protocol Online.


ClustrMap

<html> <a href="http://www2.clustrmaps.com/counter/maps.php?url=http://openwetware.org/wiki/Kai_Yuet/" id="clustrMapsLink"><img src="http://www2.clustrmaps.com/counter/index2.php?url=http://openwetware.org/wiki/Kai_Yuet/" /> </a> </html>