Jessica Karen Wong/Notebook/2007-7-16

From OpenWetWare

Jump to: navigation, search
T9002 Colony PCR Gel
T9002 Colony PCR Gel

Contents

Gel

  • Ran a gel of the overnight colony PCR's of T9002-3K3
    • Loaded T9002-3K3 from 7-13 (1-8), space, ladder, space, same 9-16 in top lane
    • Loaded T9002-3K3-D from 7-11 (1-8), space ladder space t9002-3k3-s from 7-11 (1-8)
    • Got varying sizes but none large enough




T9002 Pieces

PCR of T9002 pieces
PCR of T9002 pieces
  • Got the primers to PCR Eco/Xba, Xba tails onto the pieces of T9002 aka F2620 and E0240
  • Diluted primers to 40 uM to PCR on the tails
  • Made 1 100ul rxn of each with vent using a 3x dilution of DNA
  • E0240 was run at 53.5 and F2620 at 53
  • Ran a gel of it, F2620 looks the right size, E0240 is too small
  • Redoing the E0240 PCR overnight on a gradient 51-56
  • PCR cleaned F2620
  • Set up overnight digests:
    • F2620 (15ul) in buffer 4 cutting Mfe/Xba
    • 3K3 (15ul) in EcoR1 buffer cutting E/X
    • 1AK3 (4ul) in EcoR1 buffer cutting E/X


Sequencing

  • Got back all of the sequencing done july 11, 12
  • However, we realized that we haven't been making glycerols of the things we've sent for sequencing
  • Can't trust the repeating sequences because they may not have been done from the same colony and may not be able to use that colony in the future
  • Made overnights of every construct that looks to be the right size
  • They should all be constructed, scarred, and in the right plasmid
    • E0240-1AK3 from 7/8/07 colonies #1 and #2
    • E0240-3K3 from 7/13/07 colony #9
    • I2047-3K3 from 7/11 #2 and #4
    • I2055-3K3 from 7/13 #3
    • I2055-1AK3 from 7/13 #4 and #16

I2055

  • Ligated I2055 (that contains pcr'ed in promoter and was digested m/n) and 3K3
  • Transformed 3ul of ligation and plated

Primers

  • Ordered new I2055_BB_F and I2056_BB_F primers
  • Spacing was off between the anticipated RBS site and the start of GFP
  • I2055-F 8mer Xba1 ATGCGTAAAGGAGAAGAACTTTTC 52.4
    • CTTAGTAG TCTAGA TGCGTAAAGGAGAAGAACTTTTC
  • I2055-R 8mer xba1 NOT1 ecor1 GTGCTCAGTATCTCTATCACTGATAGG 52.0
    • TCAGCGAT CTCTAGAAGCGGCCGCGAATTC GTGCTCAGTATCTCTATCACTGATAGG
  • I2056-F 8mer Xba1 ATGGCTTCCTCCGAAGACG 54.0
    • CTTAGTAG TCTAGA TGGCTTCCTCCGAAGACG
  • I2056-R same as I2055-R
Personal tools