
From OpenWetWare

Jump to: navigation, search

August 2nd

  • Miniprep B0034 (2)
  • Digest those with 2 xylR minipreps from yesterday
  • Ran Gel
  • Designed Primers for xylR Total and middle for sequencing

xylR total 3732929..3734180

Extended for primers 3732860…3734210




Front Gaattcgcggccgcttctagag TCGTTAAAGG TGCGATTCTG

End AATTGTCGG CGTCACATCAG tactagtagcggccgctgcag

Reverse complement Ctgcagcggccgctactagta CTGATGTGACGCCGACAATT

Middle for sequencing: Forward GCTACAAACG CTACCACCGC


Personal tools