IGEM:MIT/2005/Receiver Head Unit: scFv

From OpenWetWare

Jump to: navigation, search

Contents

POC

Alias: Jenny
Location(s): BUG Lounge, Kate's Lab
E-mail: JennyN@mit.edu

This is what I'm working on currently.

Function

  • To provide a landing site for ligand.
  • To cause dimerization/conformational change in the Receiver.
  • To transmit signal to Receiver.
  • Will use anti-fluorescein scFv for test phase.
  • Ultimately use anti-rabbit scFv for system.

Device Depiction

Device Parts

Current Status

Experiments Status
FWD for Testing scFvs using anti-FLAG
CATCAT GAATTC GCGGCCGC T TCTAGA TG GACGTCGTTATGACTCAAACACC
-rand- -EcoRI --NotI--   -XbaI[---]      Primer
                              start
  • Primers have been designed for biobrick format.
  • pCT-4-4-20, pCT302 S101A, pCT-4M5.3 anti-fluorescein plasmids miniprepped
FWD: 5' CATCAT GAATTC GCGGCCGC T TCTAGA GACGTCGTTATGACTCAAACACC 3'
         rand   EcoRI   NotI      XbaI       Primer
REV: 5' GCTCAT CTGCAG GCGGCCGC T ACTAGT TTATTA CTTATCATCATCATCCTTATAATC GGAGACGGTGACTGAGGTTCC 3'
         rand   PstI   NotI       SpeI   Stop          FLAG Tag                 Primer

Experiments

  • To test whether the scFvs are expressed? How?
  • We need constitutive promoter with RBS upstream of it. There is one in the library available. Biobrick scFv onto RBS/promoter, and it should express. Do a western blot to see if protein expression by using FLAG tag. We need anti-FLAG antibody (ask Natalie).

Completed Work

Open Issues/Questions

Additional Information

Anti-rabbit

Sequence: Sequence of synthetic construct anti-rabbit IgG scFV mRNA, partial cds
Paper: scFv Antibody Piezoimmunosensors
Summary: Summary scFvSensor
Personal tools