IGEM:Imperial/2010/Output module/EGFP

From OpenWetWare

Jump to: navigation, search

Notes on EGFP

  • the N-terminal half of EGFP (1−128 amino acids; light gray) and C-terminal half of EGFP (129−238 amino acids; dark gray), respectively.
  • in the article: Interacted protein A and protein B are linked to opposite ends of the split VDE. Interaction between protein A and protein B accelerates the folding of N- and C-terminal VDE and protein splicing occurs. The N- and C-terminal halves of EGFP are linked together by a normal peptide bond to yield the β-can structure (green), in which the fluorophore is formed.
  • translation=
  MVSKGEELFTGVVPILVELD
  GDVNGHKFSVSGEGEGDATY
  GKLTLKFICTTGKLPVPWPT
  LVTTLTYGVQCFSRYPDHMK
  QHDFFKSAMPEGYVQERTIF
  FKDDGNYKTRAEVKFEGDTL
  VNRIELKG (128aa)
          IDFKEDGNILGH
  KLEYNYNSHNVYIMADKQKN
  GIKVNFKIRHNIEDGSVQLA
  DHYQQNTPIGDGPVLLPDNH
  YLSTQSALSKDPNEKRDHMV
  LLEFVTAAGITLGMDELYK (239aa)
  • nucleotide sequence=
      61                                        atgg tgagcaaggg cgaggagctg
     121 ttcaccgggg tggtgcccat cctggtcgag ctggacggcg acgtaaacgg ccacaagttc
     181 agcgtgtccg gcgagggcga gggcgatgcc acctacggca agctgaccct gaagttcatc
     241 tgcaccaccg gcaagctgcc cgtgccctgg cccaccctcg tgaccaccct gacctacggc
     301 gtgcagtgct tcagccgcta ccccgaccac atgaagcagc acgacttctt caagtccgcc
     361 atgcccgaag gctacgtcca ggagcgcacc atcttcttca aggacgacgg caactacaag
     421 acccgcgccg aggtgaagtt cgagggcgac accctggtga accgcatcga gctgaagggc
     481 atcgacttca aggaggacgg caacatcctg gggcacaagc tggagtacaa ctacaacagc
     541 cacaacgtct atatcatggc cgacaagcag aagaacggca tcaaggtgaa cttcaagatc
     601 cgccacaaca tcgaggacgg cagcgtgcag ctcgccgacc actaccagca gaacaccccc
     661 atcggcgacg gccccgtgct gctgcccgac aaccactacc tgagcaccca gtccgccctg
     721 agcaaagacc ccaacgagaa gcgcgatcac atggtcctgc tggagttcgt gaccgccgcc
     781 gggatcactc tcggcatgga cgagctgtac aagtaa

Reference: EGFP on NCBI

  • nucleotide sequence: atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctacggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa


  • the bacteria were allowed to express recombinant protein with IPTG for 3 h at 25 °C and 10 μL of LB medium containing the bacteria was streaked onto LB-agarose plates and incubated overnight at 25 °C. The bacteria on the plates were illuminated with blue-LED at 470 nm (LAS-1000plus, Fujifilm), emitting maximum at 510 nm, which was detected by a cooled CCD equipped with an emission filter (530DF30).
Personal tools