Goldschmidt/sequence

From OpenWetWare

Jump to: navigation, search

>mystery sequence
CTTCGACTACGATCTGAAGAAGATGGCCGCGAAGATCTACGGCACCGAGG
ACGACAAGCACCCGGGCTGCGCCCGGACTTACCGGTACGCCGACCGGTTC
ATCGGCGGGAAAGTCACCCTGGTCAACCCCCCGAAGATGAACGAGCCTTA
TGACGCGTTCTTCCTGACCCCGCGGCAGATGCGGGCCAAGATCGCGGAGA
AGGGCTGGGAGCGGTGCGTCGCCCACCAGACCCGCAACGTGCCCCACAGC
GGCCACGAGTGGCTGATGAAGCATTCCTGGATCGCCTGCCACGCCGACCA
GCCGGTGGAGAAGACCATCACCGGGGTCGTGGTCAGCGCGGTCATGGGCG
AGAAGCGTAAGGGCGACTATATCGATGAAGCGATCGTACTCACCCACGAT
GCCCTGAGAAAGTACGGCTACTTCCGGGAGGACGTGCACCTCACGTCGAT
CATTATGTGGGATATGCGTTACGCCGGCCCGAAGGAAGCCATTTTCCACG

Personal tools