Endy:Writing:CCfGDScript
From OpenWetWare
PLEASE DO NOT EDIT. THANKS!
Title: Adventures in Synthetic Biology
- Story: Drew Endy, Isadora Deese, & The MIT Synthetic Biology Working Group
- Illustrator: Chuck Wadey -- www.chuckwadey.com
Chapter 1 - Programming DNA
- Page 1. River of Life
- Setting -- (Dude is squatting close to a river of cells) little amorphous, faceless, bacterial cells burbling along replicating and racing from the distant past into the distant future (let's call this the River of Life?). The first half of Hardy's poem Heredity about the "family face" sets the mood. Sally and Dude stand overlooking the burbling river of replicating cells. Dude wants to get the cells to do something. Sally does too, but she's feeling more circumspect about taking responsibility for the consequences of success.
- Dialog
- Dude: Check out those bacteria.
- Sally: Careful--not too close.
- Dude: Imagine what might become possible if they were working for us!
- Sally: Hmm... are you sure you understand enough about what you want to do? You don't want to make things worse.
- Dude: We'll only find out by trying! Let's grab one! Hi there Buddy.
- Page 2. Opening the Hood
- Setting -- Dude has grabbed hold of a squirmy bacteria (buddy). Buddy doesn't really care at this point what's going on, just moving on through the river of life. Sally and Dude need to discuss how Buddy works and how they can program buddy (this might best play out over the next two panels?).
- Dialog
- Dude: How do these things work anyway?
- Sally: Come inside, I'll show you!
- Sally: All living things run on programs made of DNA. Each of these cells has their own DNA program, called the genome.
- (ZZZZT! Sally "transports" herself and Dude inside Buddy)
- Sally: Check it out!
- Dude: What?! Whoah!
- Setting -- Dude and Sally are now inside, or looking inside the cell, they're considering this long snake object, a double helix string of A, T, C, G.
- Dialog
- Sally: There it is -- the genome -- the master program that's running the cell.
- Dude: So this is what we change to reprogram this critter? Looks easy!
- Sally: Change or add to it, but it's not so easy, because nobody completely understands how the program works exactly in the first place.
- Dude: Ah, a worthy challenge. I accept!
- Sally: What exactly did you have in mind?
- Dude: Hmm...
- Page 3. Drawing Board
- Setting -- Back outside cell, Dude is scheming and sketching out lots of ideas (at a board?). Sally is observing thoughtfully. Possible sketches on the board include bacteria blasting off into space, a bacteria chorus line, bacteria toothpaste (Buddy Brand!), etc. Buddy is bouncing quietly off the walls in the background.
- Dialog
- Later, back in the lab...
- Dude: Bacteria balloons!
- Sally: I'm not sure that will work.
- Dude: Wanna bet?
- Sally: Uh huh?
- Dude: All I need to do is make them form a closed film, then start producing hydrogen gas, then...
- Dude: (working on sketch at board)
- Dude: OK, got it. So, uh, how do I program this little guy (points at Buddy, Buddy stops bouncing)?
- Sally: First you need to assemble the DNA parts that encode your program.
- Sally: Get them from the catalog.
- (Sally hands Dude the Registry of Parts book -- the title of the book should be visible at the top of the book's page, as in this Registry is a real thing. Check out here and here for an example sheet in the Book).
- Dude: One Balloon-o-Genesis and one Gas-o-Matic module.
- Dude: Cool, here they are! Now what?
- Sally: Load the DNA into our little friend here.
- Sally: What do you think, Buddy?
Page 4. Rubber Meet Road
- Setting -- Still in workspace. Dude is ready to get to work, but needs advice from Sally. Buddy is still bouncing around.
- Dialog
- Dude: DNA's ready to go. (Buddy makes a break for it.) Help me catch him!
- Dude: (Dude finally catches Buddy, loads in DNA (zoom in on cell, showing DNA going inside)).
- Buddy: MEEP!
- Sally: You might want to stand back.
- Buddy: (Looking a little different than before, maybe a bit squeamish)
- Dude: He's changing!
- Buddy: (starts dividing a lot, making a balloon made up of many Buddy's on the floor)
- Buddy: pop, Pop, pop, Pop, POP!
- Panel 5. Icarus
- Setting -- Still in workspace. Dude and Sally are watching Buddy with great interest, waiting to see what happens.
- Dialog
- Dude: Check it out! It's working!!! SWEET (does a little dance)
- Buddy Balloon: (looking a little greenish)
- Sally: Hmm. That doesn't look right
- Buddy Balloon: (BANG!)
- Dude: Whaaat? What was that?
- Sally: You forgot to tell your program to stop! Buddy kept going until it was too late.
- Dude: Hmm. I better learn more about what I'm doing before I try anything else.
- Sally: (sarcastic, slopping some of Buddy's balloon residue off of her) Gee, you think? (we can still recognize bits of Buddy -- he's still alive and kicking, just all over the lab)
- to be continued...
Chapter 2 - Engineered Genetic Devices
- Page 1. Pondering
- Setting -- Dude is somewhere (hilltop, overlooking River of Life) trying to figure out what went wrong with Buddy. Sally is nearby.
- Dialog
- Dude: I know bacteria balloons could work, if only there was some way to stop them from growing until they explode!
- Sally: Let me introduce you to a friend of mine. It's called an INVERTER device. It could be the answer you're looking for.
- Dude: (sarcastic tone) Gee, thanks for telling me ahead of time!
- Dude: (serious tone) What the heck is an INVERTER?
- ZZZZT!
- Setting -- Back at the drawing board. This time Sally is schooling Dude. There's a sketch of a genetic inverter on the board. picture of inverter and accompanying text.
- Sally: OK, pay attention! An INVERTER is a combination of basic DNA parts that, working together, turn something upside down. ON becomes OFF, Low becomes High, and so on.
- Whiteboard text for Parts of an Inverter
- Ribosome Binding Site (RBS) - Basic elements that start the process of protein synthesis.
- Repressor - A gene that encodes a particular type of protein that will bind to DNA site in a specific operator part and cause changes in the rate of gene expression.
- Terminator - Special elements that decrease the flow of RNA polymerase along DNA, sometimes to zero!
- Operator - Stretches of DNA that contain repressor protein binding sites and RNA polymerase binding and initiation sites. With a repressor protein, the operator part will be turned off. Without a repressor protein, the operator part will be turned on, allowing RNA polymerase to bind and initiate a HIGH output signal.
- Sally: You could have used an inverter DEVICE to help prevent Buddy's unfortunate accident.
- Buddy: (weakly) meep!
- Dude: Uhm... why's it called a DEVICE?
- Sally: You'd prefer THINGAMAJIGGY?
- Dude: It's enough you're a know-it-all, you don't have to rub it in.
- Sally: (smile) We call an inverter a DEVICE in order to hide all the details of how it works. For example, here's some DNA code, now you tell me what it does:
- (Sally shoots out a string of DNA code, "TAATACGACTCACTATAGGGAGA", from the tip of her pointer, Dude ducks as it zooms over his head)
- Dude: Hey! Watch it! I have no idea, OK? What is it?
- Sally: Don't feel bad. My point is, you shouldn't have to memorize every last piece of DNA. We're going to hide all these details inside the DEVICE.
- (the string of DNA code zips around to land in a black box. Sally slams the box shut.)
- Dude: Phew (relief). How did you do that?
- Page 2. Black Box
- Setting -- Sally is still schooling Dude. There's some Buddy residue that at this point has started to recover and is growing into a normal, single Buddy cell. There's still a sketch of a genetic inverter on the board.
- Dialog
- Sally: This is how you make an INVERTER DEVICE. First a RBS, then a Repressor, then a Terminator followed by a break. Finally grab another piece of DNA and put an Operator there. Wrap it all in a Black Box and VOILA! We've got ourselves a genetic inverter! High Input, Low Output and vice versa! (Sally's looking pretty kickass at this point)
- Dude: (looking not so kickass, slowly says...) ....OK, but, uh, how does the, uh, inverter(?) work?
- Sally: (lecture mode) ...when the input signal is high, the repressor protein is kicked up, and that turns off the output signal. OK?
- Dude: (earnest student mode) Got it!
- Sally: But, the entire point of all this is that we are gonna hide all these details inside a black box, so that you don't have to remember all this stuff (Sally gives Dude a Black Box with some DNA dangling in one side and out the other)
- Dude: Sweet. Genetic Devices. I'm gonna make a whole bunch of 'em!
- Sally: Good luck!
- To be continued
Chapter 3 - Common Signal Carriers
- Page 1. Practice Makes Perfect
- Setting -- Dude is in his workshop, making genetic devices (inverters). He's got a ton of black boxes laying all over the place. Sally is sauntering in. Buddy is dancing about (or absent if no room).
- Dialog
- Sally: Dude! What are you doing?
- Dude: What does it look like? Making genetically encoded inverters, of course! (smiling)
- Sally: Looks like you've really gotten the hang of it. I've been wanting to make a ring oscillator (Reference 1)... All I need are three inverters.
- Dude: No problem! You can have the pick of the crop!
- (Dude pridefully hands Sally three boxes, but with different "wires" sticking out of each box: A->B, C->D, E->F).
- Sallys: Thanks! I think... (looks at Dude's inverters kinda funny... walks out)
- time passes
- Setting -- Dude is still in his workshop, looking proudly at his myriad genetic devices (they can have all sorts of labels on them). Sally enters, her hair is mussed, and she looks thoroughly frustrated.
- Sally: Dude! What were you doing?
- Dude: Yikes! What's wrong? (gulp)
- Sally: Your genetic devices, that's what. I can't hook them up to each other. (angry)
- Dude: Aye! Why not?
- Sally: They send and receive signals using different proteins!
- Sally: Your genetic devices are no good (sweeps her hand across all of Dude's workshop)
- Dude: Hey, take it easy. The Dude is still learning (sigh).
- Page 2. Resurrection
- Setting -- Dude is looking down. Sally is about to give him a boost of encouragement, or open fire depending on how things go.
- Dialog
- Sally: C'mon. Make some better devices that can be reused in combination.
- Dude: How?
- Sally: OK, so we know the problem with your old devices is that the Input and Output signals are carried by different proteins.
- Dude: Right. And we know how to measure protein concentrations!
- (Dude points at Buddy, Buddy looks happy)
- Sally: So? They're still different proteins (patient)
- Dude: Well, I'll get a prize for discovering an important protein!
- (Dude looks important, Buddy mirrors importance)
- Buddy: MEEP!
- Sally: So what! That's not going to help me to connect your devices to each other! (getting cross)
- Dude: (less sure) But... the state of a cell is best defined by the number of molecules that make up the cell?
- Sally: Maybe not! Why don't you try something different?
- Time passes.
- Setting -- Dude is buring the midnight oil... sketches of inverters back on board in the workshop...
- Dude: (to himself) Hmm...
- Dude: (to himself) What about? (works out something at the board, re-draws correct inverter schema)
- Dude: Check this out!
- Sally: What? (interested)
- Dude: Now my inverters send and receive signal via the rates of gene expression into and out of the device!
- Sally: Nice! (congratulatory)
- Page 3. Current for Gene Expression
- Setting -- At the drawing board, showing a genetic inverter.
- Dialog
- Dude: When the input rate is HIGH, the Repressor protein gets made, it shoots up and lands on the operator site, and thus the output rate is LOW. When the input rate is LOW, no Repressor gets made, so the output is HIGH!
- Sally: Very good! But what exactly is the rate? (cautiously optimistic)
- Dude: Rate of gene expression!
- Sally: What's that exactly?!
- Dude: Ah, the student becomes the master.
- (Sally rolls her eyes.)
- Dude: Pretend you are standing on the DNA where the input signal arrives.
- Sally: Good. Now what? (patient)
- Dude: Rate of gene expression is the number of RNA polymerase molecules that trundle past you each second, let's call this POlymerase Per Second or PoPS (reference 2)!
- Sally: Excellent!
- Dude: PoPS is the "flow" of RNA polymerase along my DNA wire
- Sally: Kinda like electrical current!
- Dude: Yes!!
- Page 4. Consequences of Success
- Sally: (sudden concern) And, how do we measure PoPS?
- Dude: (grinning) I don't know, but if I figure it out, you can rename it after me!
- Sally: (thinking of having to use 1 gigadude inverters, the horror!)
- Sally: this common signal carrier, PoPS, solves the problem of connection our genetic devices. You've learned something very big Dude.
- Dude: And all I had to was change how I organized my devices DNA. Think of the possibilities. Cells programmed to terminate if they divide too many times, engineered insulin producing cells...
- Sally: No more Buddy Balloons, I hope?
- Dude: Uh, no, of course not (clears his throat).
- (we can see a successful, smiling Buddy Balloon hovering behind Dude.)
- Sally: I wonder if natural biological systems use PoPS?
- Dude: Who knows, but look at us! We're building stuff!!
- References, Inspiration & Acknowledgements, & Contact
- References
- Reference 1. Elowitz & Leibler S. Nature v403 p335
- Reference 2. Che et al. "A common signal carrier for genetic devices" (manuscript in prep).
- Inspiration & Acknowledgements
- Morton "Life, reinvented" WIRED 13.01
- Gonick & Wheelis, The Cartoon Guide to Genetics
- McCloud, Understanding Comics
- Howtoons, www.howtoons.org
- Image & Meaning, web.mit.edu/i-m/
- Thanks to Joost Bonsen, Felice Frankel, Larry Gonick, Saul Griffith, Heather Keller, Ilya Sytchev, and Ty Thomson
- Contact
- Drew Endy via endy@mit.edu
- Chuck Wadey via www.chuckwadey.com
- References


