Endy:Notebook/DNA Sequence Refinement/RNA Stability Elements

Abstract/Summary

My project attempts to investigate a method of controlling gene expression to manipulate protein production. Proteins are known as the building blocks of life and play critical roles in the body. The fundamental principle of molecular biology is the flow of information from DNA to RNA to proteins and is so important that it is called the "central dogma." As a high school student just getting started with molecular biology, my principle objective is to work on a project that would give me insight into this "central dogma." The methodology I plan to use is one of research followed by experimentation. From the research I have done so far with the help of Dr. Cesar Rodriguez, I have investigated the possibility of using hairpin secondary structures in the stabilization of mRNA. Literature indicates possible hairpin configurations that extend the half lives of mRNA. My goal is to compare protein production with and without the presence of these secondary structures and thus be able to draw conclusions of the effects of hairpins in gene expression. I plan to conduct the wet lab portion with the help of Mr. Jerome Bonnet.

Literature

[1] "Library of Synthetic 5' secondary structure to manipulate mRNA stability in E.coli", by Trent A.,Carrier and G.D.Keasling

[2] "Thermodynamic parameters for Loop formation in RNA and DNA hairpin tetraloops", by Vincent P. Entao and Ignacio Tinoco, Jr.

[3] "A thermodynamic study of unusually stabe RNA and DNA hairpins", by Vincent P. Entao and Ignacio Tinoco, Jr., Sandy Y. Lai

[4] Gruber AR, Neuböck R, Hofacker IL, Washietl S (2007). "The RNAz web server: prediction of thermodynamically stable and evolutionarily conserved RNA structures". Nucleic Acids Res. 35 (Web Server issue): W335–8. doi:10.1093/nar/gkm222. PMID 17452347

Hairpin Design

Hairpin:POZO1-most stable hairpin(high delta G value and high mRNA half-life)

Step 1: Design hairpin using BioBricks guidelines

Original hairpin sequence: TCACCAGGGGTGCTCGGCATAAGCCGAAGATATCGG TAGAGTTAATATTGAGCAGCATCCCCGGTGA

1.) Insert prefix and suffix to original sequence Hairpin Sequence with prefix and suffix: gaattcgcggccgcttctagagTCACCAGGGGTGCTCGGCATAAGCCGAAGATATCGGTAGAGTTAATATTGAGCAGCATCCCCGGTGAtactagtagcggccgctgcag

2.) Make sure the hairpin sequence does not contain EcoRI, XbaI, SpeI and PstI sites

EcoRI site: GAAUUC

XbaI site: UCUAGA

SpeI site: ACUAGU

PstI site: CUGCAG

Hairpin Sequence does not contain any of the above sites