Designing and testing the qPCR primers

House keeping genes

When checking gene expressed in the BSF it is important to use housekeeping gene as a reference.
Housekeeping genes, also known as reference genes, are a set of genes that are constitutively expressed in cells and are essential for basic cellular functions.
These genes encode for proteins that are involved in fundamental cellular processes, such as cell cycle regulation, DNA replication, and metabolism.
In life science experiments, housekeeping genes are commonly used as internal controls or normalization factors to ensure accurate gene expression analysis.
Their stable expression levels across different cell types and experimental conditions make them ideal references for comparing the expression levels of other genes of interest.
Primers For example:

* HisActin-F: CGTAGGAGACGAAGCACAAA
* HisActin-R: GGTGCCAGATCTTCTCCATATC
* HisRPL8-F: GCCGTGCATACCACAAATAC
* HisRPL8-R: TTGACTGTCGAAGCCTTACC

When checking gene expressed in the BSF or gene expressed in yeast live in the BSF’s gut we will normalize the expression to housekeeping gene expressed in the BSF.

Amplicon length should be approximately 50–150 bp.
In general, primers should be 18–24 nucleotides in length.
They should be specific for the target sequence and be free of internal secondary structure.
Primer pairs should have compatible melting temperatures (within 5°C) and contain approximately 50% GC content.
Avoid complementarity and hybridization between primer pair sequences (primer-dimers).

For qRT-PCR, design primers that anneal to exons on both sides of an intron (or span an exon/exon boundary of the mRNA) to allow differentiation between amplification of cDNA and potential contaminating genomic DNA by melting curve analysis.
To confirm the specificity of your primers, perform a BLAST search against public databases to be sure that your primers only recognize the target of interest [[[4]]].

A melting curve (dissociation curve) charts the change in fluorescence observed when double-stranded DNA (dsDNA) with incorporated dye molecules dissociates, or “melts” into single-stranded DNA (ssDNA) as the temperature of the reaction is raised.
For example, when double-stranded DNA bound with SYBR® Green I dye is heated, a sudden decrease in fluorescence is detected when the melting point (Tm) is reached, due to dissociation of the DNA strands and subsequent release of the dye.
The fluorescence is plotted against temperature and then the -ΔF/ΔT (change in fluorescence/ change in temperature) is plotted against temperature to obtain a clear view of the melting dynamics. Post-amplification melting-curve analysis is a simple, straightforward way to check real-time PCR reactions for primer-dimer artifacts and to ensure reaction specificity.
Different PCR products can often be distinguished by their melting characteristics. Two peaks indicate non-specific target.

Designing and testing the qPCR primers using a standard curve is important before doing any qPCR experiments! Making sure that the obtained Ct values are valuable and reflect reality is important
For further information [[[5]]]
To perform a qPCR standard curve, you set up qPCR reactions to amplify different amounts of the DNA/cDNA sample.
Theoretically, efficient primers will result in a proportional dose-response curve.To get a good standard curve, you ideally need at least five data points over several orders of magnitude.

FOR example, dilute the cDNA by (5,10,20,40,80)
You also want to run samples in triplicate, so you can assess the repeatability.

Our qPCR software has applications to analyze standard curve. It generates the curve and calculates the efficiency of the reaction.
There are a few values you want to calculate and assess when analyzing your curve: PCR Efficiency, R2
An example of a standard curve is shown below.
Ct values on the y-axis, and the number of log DNA copies per mL on the x-axis (or cDNA dilution in our case).