Design 6 Oligo Form

From OpenWetWare

Jump to: navigation, search
SequenceSequence (5\' - 3\')
PlateRowColumnName5\' Mod(Ensure sequences are in ALL CAPS)3\' ModComments
box_v6_AA01c6.0.1.1TTGATAATAGCATT
box_v6_AA02c6.0.1.2TGTCACAATCAATAGAAAATTCGACAGAATCAAGTGTTTTCA
box_v6_AA03c6.0.1.3TCGGCATTCTACTAATAGTAGGAGGTCATTTTTGCGTCAGGA
box_v6_AA04c6.0.1.4TTAGAGAATAGCGTCCAATACACGCTGCGCGTAACCGCTACA
box_v6_AA05c6.0.1.5GGGCGCGTACTATGGTTGCTTATAACATCACTTGCAGGACGT
box_v6_AA06c6.0.1.6TGGGAAGTTTAATTTCAACTTTAAGGGAACCGAACTAAATTG
box_v6_AA07c6.0.1.7TGTCGAAAGGGTAGCAACGGCTGTGAGTGAATAACCATAGCG
box_v6_AA08c6.0.1.8ATAGCTTAGATTAAGACGCTGTTCTGACCTAAATTACTAAAG
box_v6_AA09c6.0.1.9GAATTGCTTGTCGTCTTTCCACCACCCTCAGAACCTTTTGCT
box_v6_AA10c6.0.1.10CAGTACCTACATGGCTTTTGAACATACATAAAGGTGCGCCAA
box_v6_AA11c6.0.1.11AGACAAAAGGGCGACATTCAACGTCACCAATGAAATGCCATC
box_v6_AA12c6.0.1.12TTTTCATTATATTTTCATTTGTAATGCTGTAGCTCTCGAGCT
box_v6_AB01c6.0.1.13TCAAAGCTCCCCCTCAAATGCGCGAAAGGAGCGGGAACGTGC
box_v6_AB02c6.0.1.14TTTCCTCGTTAGAATCAGAGCTCACGCAAATTAACCGGAACA
box_v6_AB03c6.0.1.15ACATTATACGAGAAACACCAGCGGTGTACAGACCAAGCGCGA
box_v6_AB04c6.0.1.16AACAAAGTTCATGAGGAAGTTTGAATTACCTTTTTTGAATTT
box_v6_AB05c6.0.1.17ATCAAAATCATAGGTCTGAGAACGCGAGAAAACTTTCCAAAA
box_v6_AB06c6.0.1.18AAAAGGCTTCCACAGACAGCCCCACCACCCTCATTAGAGGCT
box_v6_AB07c6.0.1.19GAGACTCTTAACGGGGTCAGTTAAGACTCCTTATTGAAGGTA
box_v6_AB08c6.0.1.20AATATTGACGGAAATTATTCACAAAATCACCAGTAACCGGAA
box_v6_AB09c6.0.1.21CCGCCTCACCATTAGATACATCGGTGTCTGGAAGTATTAAGA
box_v6_AB10c6.0.1.22GGAAGCCCATAAATCAAAAATCGGGGAAAGCCGGCAGGCCGA
box_v6_AB11c6.0.1.23TTAAAGGGATTTTAGACAGGATTTTTATAATCAGTTTTAGGA
box_v6_AB12c6.0.1.24ATACCACAACGTAACAAAGCTGAGTAATCTTGACAATACACT
box_v6_AC01c6.0.1.25AAAACACCACTACGAAGGCACAACATCAAGAAAACCCTCCGG
box_v6_AC02c6.0.1.26CTTAGGTTGGGTTA
box_v6_AC03c6.0.1.27AATTGTTATCCGCTCACAATTTCGTAATCATGGTCGTAGATT
box_v6_AC04c6.0.1.28TAGTTTGCCTCAGAGCCGCCAACCACCCTCAGAGCTGCCCGT
box_v6_AC05c6.0.1.29ATAAACACCTATTATTCTGAATATTATTTATCCCATTCATCG
box_v6_AC06c6.0.1.30TAGGAATCATTACCGCGCCCAACGGGTATTAAACCCAACGCC
box_v6_AC07c6.0.1.31TGTAGCATCCAAAAGGAGCCTATACCGATAGTTGCAAAATAC
box_v6_AC08c6.0.1.32GTAATGCTCATCTTTGACCCCAAGAAACCACCAGACAAATCA
box_v6_AC09c6.0.1.33ACAGTTGAAAGGAATTGAGGAAGCCAGCAGCAAATTAAGGCT
box_v6_AC10c6.0.1.34TGCCCTGTACAGGTAGAAAGACAACACTATCATAAAAAACGA
box_v6_AC11c6.0.1.35GAATGACCGAAAGACTTCAAATCACCAGTGAGACGAGCCGGA
box_v6_AC12c6.0.1.36AGCATAAAGTGTAAAGCCTGGGGCTAGTACCCGTAATAACCT
box_v6_AD01c6.0.1.37GTTTAGCAATCAAAATCACCGGCCAGCATTGACAGACTGGTA
box_v6_AD02c6.0.1.38ATAAGTTCTCAAGAGAAGGATTCTTTCCAGAGCCTAGATATA
box_v6_AD03c6.0.1.39GAAGGCTTATCCGGTATTCTAAAACCAATCAATAAAACGATC
box_v6_AD04c6.0.1.40TAAAGTTGAATAATAATTTTTGCATAACCGATATAGGACTAA
box_v6_AD05c6.0.1.41AGACTTTTACAACGGAGATTTTTAATTTTAAAAGTATCTTTA
box_v6_AD06c6.0.1.42GGAGCACTAACAACTAATAGAGGCGGTCAGTATTATGGGCTT
box_v6_AD07c6.0.1.43GAGATGGAAAAATCTACGTTACAAAATAGCGAGAGAAATATT
box_v6_AD08c6.0.1.44CATTGAAGAACCAGACCGGAAGAGAGGCGGTTTGCGAGCTAA
box_v6_AD09c6.0.1.45CTCACATTAATTGCGTTGCGCCCTTTGATAGCGAGAAGGTGG
box_v6_AD10c6.0.1.46CATCAATTTTCGGTCATAGCCTTGATATTCACAAATCCAGTA
box_v6_AD11c6.0.1.47AGCGTCAAGGCGGATAAGTGCCAGCTACAATTTTATTTAGCG
box_v6_AD12c6.0.1.48AACCTCCCGACTTGCGGGAGGAACAAGAAAAATAAAATTTTC
box_v6_AE01c6.0.1.49TGTATGGTTCAGCGGAGTGAGAAGGCCGCTTTTGCACAGCAT
box_v6_AE02c6.0.1.50CGGAACGATCCGCGACCTGCTAACAATTCGACAACAGATAAT
box_v6_AE03c6.0.1.51ACATTTGAGGATTT
box_v6_AE04c6.0.1.52GAAGGGCGATCGGTGCGGGCCCGCCATTCGCCATTGGAATTA
box_v6_AE05c6.0.1.53TTACCAGTAACGTCAAAAATGAAAATAGCAGCCTTAAAATAA
box_v6_AE06c6.0.1.54ATTTTCGAGCCAGTAATAAGAAGTAGGGCTTAATTTCGCAAG
box_v6_AE07c6.0.1.55GCGAATTATAATCCTGATTGTTTGGATTATACTTCCATTTTG
box_v6_AE08c6.0.1.56CCCTTCTGACCTGAAAGCGTACAATCGTCTGAAATAAAGAGT
box_v6_AE09c6.0.1.57TCAAGTTAATCCTGTTTGATGGTGGTTCCGAAATCGGTGGTT
box_v6_AE10c6.0.1.58TTTCTTTTATCGCGTTTTAATAACATGTTTTAAATATGCAAC
box_v6_AE11c6.0.1.59TAAAGTATTCGCAAATGGTCATAAGGATCCCCGGGCCAGCTG
box_v6_AE12c6.0.1.60GCGAAAGGGGGATGTGCTGCACAGCTTTCCGGCACAGCAAGG
box_v6_AF01c6.0.1.61CGAAGCCCATAAAAACAGGGAAGCGCATTAGACGGAACGCTA
box_v6_AF02c6.0.1.62ACGAGCGTAGGATTAGCGGGGGCCACCCTCAGAACCGCCACC
box_v6_AF03c6.0.1.63CTCAGAGCTCATAGTTAGCGTTCGGCTGTCTTTCCGACAAAA
box_v6_AF04c6.0.1.64GGTAAAGTAATTCTGTCCAGATGCGTTATACAAATTAGTTAA
box_v6_AF05c6.0.1.65CGCCTGAGTTAGAACCTACCATATCAAAATTATTTTTGCCCG
box_v6_AF06c6.0.1.66ATTTTTGAATGGCTATTAGTCCAACAGGAAAAACGTTCTTTG
box_v6_AF07c6.0.1.67ATTAGTATGACGAGCACGTATCGCTAGGGCGCTGGAAAAACC
box_v6_AF08c6.0.1.68GTCTATCTAAATCAAAAGAATAGCCCGAGATAGGGGGCCAAC
box_v6_AF09c6.0.1.69GCGCGGGGCAAACTCCAACAGGGATGGCTTAGAGCTTAATTG
box_v6_AF10c6.0.1.70CTGAATAGGGCGCGAGCTGAAGCAAGTCCGCTAGCGGTAACG
box_v6_AF11c6.0.1.71CCAGGGTTTTCCCAGTCACGAGGGACGACGACAGTACCGTAA
box_v6_AF12c6.0.1.72TAATAAGCACCCTGAACAAAGTCAGAGGGTAATTGTGCTATT
box_v6_AG01c6.0.1.73TCAGCTAATGCAGAACGCGCCACCGGAATCATAATACCGACC
box_v6_AG02c6.0.1.74CAGTAACAATAAAGAAATTGCGTAGATT
box_v6_AG03c6.0.1.75CGAACGAATAGCTG
box_v6_AG04c6.0.1.76CAAGCGGTCCACGCTGGTTTGGCCCTTCACCGCCTATTGCAT
box_v6_AG05c6.0.1.77CAAAAAGTTCATTCCATATAACAGTTGA
box_v6_AG06c6.0.1.78AGACTGGGTACCTT
box_v6_AG07c6.0.1.79AAAGCGGGGCCCTG
box_v6_AG08c6.0.1.80CCGTGCATCTGCCAGTTTGAGCGTTGTAAAACGACAGGTCGA
box_v6_AG09c6.0.1.81TTGTTCCAGAACGTGGACTCCAACGTCAAAGGGCGCAAGTGT
box_v6_AG10c6.0.1.82AGCGGTCTGCGGAATCGTCATGCTTTTGCAAAAGAAGTTTTG
box_v6_AG11c6.0.1.83CCAGAGGTCATTATACCAGTCCTGAGTAGAAGAACTCCAGAA
box_v6_AG12c6.0.1.84CAATATTACCGCCAGCCATTGTTTAATGCGCGAACTAAAACA
box_v6_AH01c6.0.1.85AAACAGAAGTACCTTTTACATCGGGAGAAACAATACATAAAT
box_v6_AH02c6.0.1.86CAATATATACAGAGGCTTTGATTCGGTCGCTGAGGCTTGCAG
box_v6_AH03c6.0.1.87GGAGTTAAATAGAAAGGAACATAATGGTTTGAAATTACTAGA
box_v6_AH04c6.0.1.88AAAAGCCTGTTTAGTATCATACGACGACAATAAACTTACGAG
box_v6_AH05c6.0.1.89CATGTAGAGAACGCGAGGCGTTCCTGAATCTTACCGAGAATT
box_v6_AH06c6.0.1.90AACTGAAAGCAAGAAACAATGAAATAGCAATAGCTCAAACGT
box_v6_AH07c6.0.1.91TCAGGAAGATCGCACTCCAGCAGGCGATTAAGTTGGACCGTA
box_v6_AH08c6.0.1.92TCCCTTAAGGGCGATGGCCCACTACGTGAACCATCAGGAAGG
box_v6_AH09c6.0.1.93GAAGAAATTTAAACAGTTCAGCCCTCGTTTACCAGACGACGA
box_v6_AH10c6.0.1.94TAAAAACATAAAACGAACTAACGTTGTAGCAATACCTCATGG
box_v6_AH11c6.0.1.95AAATACCTACATTTTGACGCTAGAATACGTGGCACAGTGCCA
box_v6_AH12c6.0.1.96TGGAAGGTTGCTTTGAATACCAAGTTACAAAATCGTTAACAA
box_v6_BA01c6.0.1.97TTTCATTTCCATTAAACGGGTGCCGACAATGACAACAACCAT
box_v6_BA02c6.0.1.98CGCCCACTCACGTTGAAAATCTTTCAAATATATTTTCTTACC
box_v6_BA03c6.0.1.99AGTATAAAGCCAACGCTCAACGAATATAAAGTACCTTATCAT
box_v6_BA04c6.0.1.100AGAATAACTTTTTAAGAAAAGTAAGCAGATAGCCGAGAACTG
box_v6_BA05c6.0.1.101GGTGCCGGAAACCAGGCAAAGTCTTCGCTATTACGTACCGAG
box_v6_BA06c6.0.1.102AGGCGAATTTTGGGGTCGAGGTGCCGTAAAGCACTGATTTAG
box_v6_BA07c6.0.1.103AGCTTGACAGGTCTTTACCCTCAAAAGGAATTACGAGGCATA
box_v6_BA08c6.0.1.104GTAAGAGTTCATCAGTTGAGAGAGGCCACCGAGTAGGATTAT
box_v6_BA09c6.0.1.105TTACATTGGCAGATTCACCAGTTCTGGCCAACAGAATCACCT
box_v6_BA10c6.0.1.106CATCAATATTCATTTCAATTACCTGAGC
box_v6_BA11c6.0.1.107ATAACGCGACTATT
box_v6_BA12c6.0.1.108AACTGGCGGGTAAT
box_v6_BB01c6.0.1.109CCAAATCATTCAAC
box_v6_BB02c6.0.1.110GAACGAATACCTTA
box_v6_BB03c6.0.1.111CGAGGCGCAGACGGTCAATCATAATCATTGTGAATCCACCAG
box_v6_BB04c6.0.1.112CAGAAGATGATAGCCCTAAAACATCGCC
box_v6_BB05c6.0.1.113CAAAAGAAGAACCG
box_v6_BB06c6.0.1.114CTTTACACCATGTT
box_v6_BB07c6.0.1.115GCGAAAGGGGATCG
box_v6_BB08c6.0.1.116TGAAACACAACCTA
box_v6_BB09c6.0.1.117GTGAATTTCTTAAACAGCTTGTTAATTGTATCGGTTGATGCA
box_v6_BB10c6.0.1.118AATCCAAGAGAATCGCCATATTTAACAA
box_v6_BB11c6.0.1.119CAACAGTGATTTTG
box_v6_BB12c6.0.1.120TAAATGCTTATCAG
box_v6_BC01c6.0.1.121TTTCGTCCATGTAC
box_v6_BC02c6.0.1.122TAGGTGTATATAAG
box_v6_BC03c6.0.1.123TTCGGAAGTTAATG
box_v6_BC04c6.0.1.124CGCAGTCCCACGGA
box_v6_BC05c6.0.1.125TAACCCACAAGAATTGAGTTAGAAACGCAAAGACATCTGAAT
box_v6_BC06c6.0.1.126TTACCGTCAAATAAATCCTCATTAAAGC
box_v6_BC07c6.0.1.127CAGAGCCCCCTCAG
box_v6_BC08c6.0.1.128GTAGCGCTTGCCTT
box_v6_BC09c6.0.1.129CCATTTGCAGGCTG
box_v6_BC10c6.0.1.130AATAATATCACCGT
box_v6_BC11c6.0.1.131TTTTGTTAAGGAAA
box_v6_BC12c6.0.1.132GATTAGTAGCGCTA
box_v6_BD01c6.0.1.133TTTTATTATCCAAA
box_v6_BD02c6.0.1.134AGTCCTGTTTTGAA
box_v6_BD03c6.0.1.135ATTTAGGTCGAGAA
box_v6_BD04c6.0.1.136AATAAACTGTTTAT
box_v6_BD05c6.0.1.137TTCCCTTAAATAAG
box_v6_BD06c6.0.1.138GTCAGATTCGTCGC
box_v6_BD07c6.0.1.139AGATGATCATCATA
box_v6_BD08c6.0.1.140AGGGACATCACACG
box_v6_BD09c6.0.1.141GGTAATATCAAACT
box_v6_BD10c6.0.1.142AGAAGTGACGGTAC
box_v6_BD11c6.0.1.143AATGCGCCACCACA
box_v6_BD12c6.0.1.144AGCCCCCAAATCGG
box_v6_BE01c6.0.1.145CTATTAAAGTTTGG
box_v6_BE02c6.0.1.146TGCCAGCCCAGTCG
box_v6_BE03c6.0.1.147TGCCTGCGGCCAGT
box_v6_BE04c6.0.1.148AGGAACCACCAGTACAAACTAAAGTACCGCACTCACAGAGGC
box_v6_BE05c6.0.1.149TCATCAAGCTCATTCAGTGAAGAAAAATCTAAAGCGATAGAA
box_v6_BE06c6.0.1.150AGATGAAAACGAGTAGTAAATACACCGCCTGCAACAGACAAT
box_v6_BE07c6.0.1.151AGTACCGGACGTTAGTAAATGTATCCCATCCTAATAACATGT
box_v6_BE08c6.0.1.152ATTGGCCCCCTTATTAGCGTTCCATCGATAGCAGCATCGGCC
box_v6_BE09c6.0.1.153AGCCGCCGAACCAGAGCCACCGCACCATTACCATTCGCTTCT
box_v6_BE10c6.0.2.1GAGCCAGTTAAAGGTGAATTAACGGAATACCCAAAAACAAAG
box_v6_BE11c6.0.2.2ACAAAGAGACTACCTTTTTAAAAAATTAATTACATCGCAGAG
box_v6_BE12c6.0.2.3CTGTCCAGGGAGCTAAACAGGGAACGTGGCGAGAAACCCAAA
box_v6_BF01c6.0.2.4CCGGAAACCGATTGAGGGAGGACGCAGTATGTTAGATCTTAC
box_v6_BF02c6.0.2.5TTTCATCAGAAGAGTCAATAGTAATGGAAACAGTAACGGATT
box_v6_BF03c6.0.2.6TCAGTAGCATATGGTTTACCAGGCAACATATAAAAAGCCCAA
box_v6_BF04c6.0.2.7GTGTGATAGAATCCTTGAAAACTTGCTTCTGTAAAGAATATA
box_v6_BF05c6.0.2.8CTCTAGATCACTGCCCGCTTTTGCATTAATGAATCTTGAGTG
box_v6_BF06c6.0.2.9GAGGTGATTAGAGCCGTCAATTCGTATTAAATCCTGCACGTA
box_v6_BF07c6.0.2.10TACGCATGGTGCCTAATGAGTGTATTGGGCGCCAGGGCAAAA
box_v6_BF08c6.0.2.11CGCTGAGAGGTTATCTAAAATTTGAGTAACATTATTGAATAA
box_v6_BF09c6.0.2.12TCCAAGAATAGCAAGCAAATCAATTTGCCAGTTACTACAGAG
box_v6_BF10c6.0.2.13CTCGAATCCACACAACATACGGGCAACAGCTGATTCCCCAGC
box_v6_BF11c6.0.2.14TGCTGAAATCTGGTCAGTTGGAGGAGCGGAATTATGGCAATT
box_v6_BF12c6.0.2.15AATCAATCCTCAAA
box_v6_BG01c6.0.3.1ACAGCCAACATGAAAGTATTATTCAGGGATAGCAAGCCCAAT
box_v6_BG02c6.0.3.2CGGAACACAGCGATTATACCAGGCGCATAGGCTGGCTGACCT
box_v6_BG03c6.0.3.3AACGTTAGTATCATCGCCTGATGACCAACTTTGAAAGAGGAC
box_v6_BG04c6.0.3.4TTGCACCCGTCGAGAGGGTTGATCACCGTACTCAGGAGGTTT
box_v6_BG05c6.0.3.5AGAAAATTGATACAGGAGTGTGAGGTTGAGGCAGGTCAGACG
box_v6_BG06c6.0.3.6GCATGATGCCTTGAGTAACAGCGCCACCAGAACCACCACCAG
box_v6_BG07c6.0.4.1GAGCCAGTTAAAGGTGAATTAACGGAATACCCAAAA
box_v6_BG08c6.0.4.2ACAAAGTAAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_BG09c6.0.4.3ACAAAGAGACTACCTTTTTAAAAAATTAATTACATC
box_v6_BG10c6.0.4.4GCAGAGTAAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_BG11c6.0.4.5CTGTCCAGGGAGCTAAACAGGGAACGTGGCGAGAAACCCAAA
box_v6_BG12c6.0.4.6TAAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_BH01c6.0.4.7CCGGAAACCGATTGAGGGAGGACGCAGTATGTTAGATCTTACT
box_v6_BH02c6.0.4.8AAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_BH03c6.0.4.9TTTCATCAGAAGAGTCAATAGTAATGGAAACAGTAACGGATT
box_v6_BH04c6.0.4.10TAAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_BH05c6.0.4.11TCAGTAGCATATGGTTTACCAGGCAACATATAAAAAGCCCAAT
box_v6_BH06c6.0.4.12AAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_BH07c6.0.4.13GTGTGATAGAATCCTTGAAAACTTGCTTCTGTAAAGAATATATAA
box_v6_BH08c6.0.4.14AGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_BH09c6.0.4.15CTCTAGATCACTGCCCGCTTTTGCATTAATGAATCTTGAGTG
box_v6_BH10c6.0.4.16TAAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_BH11c6.0.4.17GAGGTGATTAGAGCCGTCAATTCGTATTAAATCCTGCACGTAT
box_v6_BH12c6.0.4.18AAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_CA01c6.0.4.19TACGCATGGTGCCTAATGAGTGTATTGGGCGCCAGGGCAAAATA
box_v6_CA02c6.0.4.20AAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_CA03c6.0.4.21CGCTGAGAGGTTATCTAAAATTTGAGTAACATTATTGAATAAT
box_v6_CA04c6.0.4.22AAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_CA05c6.0.4.23TCCAAGAATAGCAAGCAAATCAATTTGCCAGTTACTACAGAG
box_v6_CA06c6.0.4.24TAAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_CA07c6.0.4.25CTCGAATCCACACAACATACGGGCAACAGCTGATTCCCCAGCTAA
box_v6_CA08c6.0.4.26AGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_CA09c6.0.4.27TGCTGAAATCTGGTCAGTTGGAGGAGCGGAATTATGGCAATTTAA
box_v6_CA10c6.0.4.28AGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_CA11c6.0.4.29AATCAATCCTCAAATAAAGAAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_CA12c6.0.5.1ACAGCCAACATGAAAGTATTATTCAGGGATAGCAATAAAGAAAC
box_v6_CB01c6.0.5.2TCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_CB02c6.0.5.3CGGAACACAGCGATTATACCAGGCGCATAGGCTGGTAAAGAA
box_v6_CB03c6.0.5.4ACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_CB04c6.0.5.5AACGTTAGTATCATCGCCTGATGACCAACTTTGAATAAAG
box_v6_CB05c6.0.5.6AAACTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_CB06c6.0.5.7TTGCACCCGTCGAGAGGGTTGATCACCGTACTCAGTAAAGAAAC
box_v6_CB07c6.0.5.8TCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_CB08c6.0.5.9AGAAAATTGATACAGGAGTGTGAGGTTGAGGCAGGTAAAGAAA
box_v6_CB09c6.0.5.10CTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_CB10c6.0.5.11GCATGATGCCTTGAGTAACAGCGCCACCAGAACCATAAAGAAA
box_v6_CB11c6.0.5.12CTCGGATGCGCCACGCAGGATTGGGGCGCGCCCGCGG
box_v6_CB12c6.0.5.13GCCCAATAGGAACCACCAGTACAAACTAAAGTACCGCACTCACAGAGGC
box_v6_CB01c6.0.5.14CTGACCTTCATCAAGCTCATTCAGTGAAGAAAAATCTAAAGCGATAGAA
box_v6_CB02c6.0.5.15AGAGGACAGATGAAAACGAGTAGTAAATACACCGCCTGCAACAGACAAT
box_v6_CB03c6.0.5.16GAGGTTTAGTACCGGACGTTAGTAAATGTATCCCATCCTAATAACATGT
box_v6_CB04c6.0.5.17TCAGACGATTGGCCCCCTTATTAGCGTTCCATCGATAGCAGCATCGGCC
box_v6_CB05c6.0.5.18CCACCAGAGCCGCCGAACCAGAGCCACCGCACCATTACCATTCGCTTCT
box_v6_CB06*****
box_v6_CB07*****
box_v6_CB08*****
box_v6_CB09*****
box_v6_CB10*****
box_v6_CB11*****
box_v6_CB12*****
box_v6_CC01*****
box_v6_CC02*****
box_v6_CC03*****
box_v6_CC04*****
box_v6_CC05*****
box_v6_CC06*****
box_v6_CC07*****
box_v6_CC08*****
box_v6_CC09*****
box_v6_CC10*****
box_v6_CC11*****
box_v6_CC12*****
box_v6_CD01*****
box_v6_CD02*****
box_v6_CD03*****
box_v6_CD04*****
box_v6_CD05*****
box_v6_CD06*****
box_v6_CD07*****
box_v6_CD08*****
box_v6_CD09*****
box_v6_CD10*****
box_v6_CD11*****
box_v6_CD12*****
box_v6_CE01*****
box_v6_CE02*****
box_v6_CE03*****
box_v6_CE04*****
box_v6_CE05*****
box_v6_CE06*****
box_v6_CE07*****
box_v6_CE08*****
box_v6_CE09*****
box_v6_CE10*****
box_v6_CE11*****
box_v6_CE12*****
box_v6_CF01*****
box_v6_CF02*****
box_v6_CF03*****
box_v6_CF04*****
box_v6_CF05*****
box_v6_CF06*****
box_v6_CF07*****
box_v6_CF08*****
box_v6_CF09*****
box_v6_CF10*****
box_v6_CF11*****
box_v6_CF12*****
box_v6_CG01*****
box_v6_CG02*****
box_v6_CG03*****
box_v6_CG04*****
box_v6_CG05*****
box_v6_CG06*****
box_v6_CG07*****
box_v6_CG08*****
box_v6_CG09*****
box_v6_CG10*****
box_v6_CG11*****
box_v6_CG12*****
box_v6_CH01*****
box_v6_CH02*****
box_v6_CH03*****
box_v6_CH04*****
box_v6_CH05*****
box_v6_CH06*****
box_v6_CH07*****
box_v6_CH08*****
box_v6_CH09*****
box_v6_CH10*****
box_v6_CH11*****
box_v6_CH12*****
Personal tools