Davidying: Refactoring the M13 Genome
Old M13.1 Refactoring Summary (Click here for new design)
| Overlapping regions | Description of modification and/or limitation |
|---|---|
| Separated g2/g10 ORF from the g5 promoter/g5 RBS | Repeated g2/g10 ORF and disrupt the new coding sequence with silent mutations to disrupt the g5 promoter sequence, and to prevent homologous recombination. Added two overlapping restriction sites (ApaI and AvrII) at the boundary between the two parts.Limitation: I considered separating the g5 promoter from the g5 RBS, but I was not sure of the correct technique to use in order to preserve function in both after separation. |
| Separated the g5 ORF from the g7 RBS. | Repeated g5 ORF and disrupt the new ORF coding sequence with silent mutations, as above. Added two overlapping restriction sites (KasI and MfeI) at the boundary between the two parts. |
| g2 and g10 ORFs | I was unsure whether such a large piece (g10) could be separated, because one would have to introduce many point mutations in g2 to prevent direct repeats, and I wasn't sure if the phage could tolerate this much. |
| g7 ORF, g8 promoter, g9 RBS, g9 ORF | This site seemed too complex to separate at the current time, with four elements overlapping. Also, the fact that g9 lacks a promoter led me to think that the g8 promoter, which is very close to the g9 ORF, may act as the g9 promoter. This made me reluctant to separate these. |
| g8 RBS and g9 ORF | Can be done as seen above. |
| g3 promoter and g8 ORF | Can be done as seen above. |
Modifications
1. Separate the g2/g10 ORF from the promoter g5/RBS g5.
Original: (Red = g2/g10 ORF, underline = g5 promoter, italics = g5 RBS) c,caa,cgt,cct,gac,tgg,tat,aat,gag,cca,gtt,ctt,aaa,atc,g | ca,taa | ggta | attcaca
a. Repeat red part (g2/g10 ORF) and disrupt the new coding sequence with silent mutations to disrupt the g5 promoter sequence, and to prevent homologous recombination: c,caa,cgt,cct,gac,tgg,taC,aaC,gaA,ccC,gtA,ctA,aaG,atT,gcG,taaccaacgtcctgactggtataatgagccagttcttaaaatcg | cataaggta | attcaca
b. Add two overlapping restriction sites (ApaI and AvrII) at the boundary between the two parts. c,caa,cgt,cct,gac,tgg,taC,aaC,gaA,ccC,gtA,ctA,aaG,atT,gcG,taaGGGCC|C|CTAGGccaacgtcctgactggtataatgagccagttcttaaaatcg | cataaggta | attcaca ApaI AvrII
Final sequence: ccaacgtcctgactggtaCaaCgaAccCgtActAaaGatTgcGtaaGGGCCCCTAGGccaacgtcctgactggtataatgagccagttcttaaaatcgcataaggtaattcaca
2. Separate the g5 ORF from the g7 RBS.
Original: (Red = g5 ORF, underline = g7 RBS) gttccggctaagtaa | c
a. Repeat red part (g5 ORF) and disrupt the new ORF coding sequence with silent mutations, as above.
gtC,ccT,gcG,aaA,taagttccggctaagtaac
b. Add two overlapping restriction sites (KasI and MfeI) at the boundary between the two parts. gtC,ccT,gcG,aaA,taaGGCGC|C|AATTGgttccggctaagtaac
Final sequence: gtCccTgcGaaAtaaGGCGCCAATTGgttccggctaagtaac
New Parts
- BBa_M31337: Project part, contains M13K07 genome from HpaI site to BamHI site
- BBa_M31338: Coding sequence, contains partial gene 2 (and embedded gene 10) from HpaI site to end of gene, marked by ApaI site.
