Common primer sequences

From OpenWetWare

Jump to: navigation, search
  • M13 forward sequencing primer (-20): GTAAAACGACGGCCAGT
  • M13 forward sequencing primer (-40): GTTTTCCCAGTCACGAC
  • M13 forward sequencing primer (-47): CGCCAGGGTTTTCCCAGTCACGAC
  • M13 reverse sequencing primer: (-24): AACAGCTATGACCATG
  • M13 reverse sequencing primer: (-48): AGCGGATAACAATTTCACACAGGA
  • T3 promoter: ATTAACCCTCACTAAAGGGA
  • T7 universal primer: TAATACGACTCACTATAGGG
  • T7 Terminator: GCTAGTTATTGCTCAGCGG
  • SP6 promoter: CATACGATTTAGGTGACACTATAG
  • SP6 universal primer: ATTTAGGTGACACTATAG
  • VF2: tgccacctgacgtctaagaa
  • VR: attaccgcctttgagtgagc
Personal tools