Biomod/2014/Design

<html>

<head>
 <title> Mainpage </title>
  <style>
    body{
    align: left;
    width: 1200px;
    height: auto;
    margin: 0 auto;
    background-color:#be1e3c;
    border:#be1e3c thin solid;
    }
    #goTopBtn {POSITION: fixed;TEXT-ALIGN: center;LINE-HEIGHT: 30px;WIDTH: 100px;BOTTOM: 35px;HEIGHT: 100px;FONT-SIZE: 12px;RIGHT: 30px;}
    #content{margin:0;padding:0;border:0px;}
      /*hidden section*/
      .firstHeading{display:none;}
      #sidebar-main{display:none;}
      #p-cactions{display:none;}
      #p-personal{display:none;}
   </style>
</head>

<body>
 <center>

  <table align="center" border="0">
   <colgroup  span="4"></colgroup>
    <tr>
     <th>
       <a href="http://www.tu-braunschweig.de/index.html"><img src="http://openwetware.org/images/thumb/2/27/Nanoscooter_TUBS-siegel.jpg/800px-Nanoscooter_TUBS-siegel.jpg" width="383" height="142" alt="Logo TU Braunschweig"></a>    
     </th>
     <th>
      <img src="http://openwetware.org/images/thumb/c/c3/Nanoscooter_Gruppenfoto-Banner.jpg/800px-Nanoscooter_Gruppenfoto-Banner.jpg"
       width="463" height="142"
       alt="our group"
       title="our group (Nanoscooter) for Biomod competition">
     </th>
     <th><img src="http://openwetware.org/images/2/24/Nanoscooter.jpg"
        width="165" height="142" alt="Logo Nanoscooter">  </th>

  </table>

<h1> Team Nanoscooter Braunschweig </h1>

  <colgroup width="158" span="6"></colgroup>
   <tr>
    <th bgcolor="#be1e3c"><center><font size="+1"><a href="Braunschweig"><span style="color:white">Home</span></a></font></center></th>
    <th bgcolor="#be1e3c"><center><font size="+1"><a href="Team"><span style="color:white">Team</span></a></font></center></th>
    <th bgcolor="#be1e3c"><center><font size="+1"><a href="idea"><span style="color:white">Project idea</span></a></font></center></th>
    <th bgcolor="#be1e3c"><center><font size="+1"><a href="results"><span style="color:white">Results</span></a></font></center></th>     
    <th bgcolor="#be1e3c"><center><font size="+1"><a href="perspectives"><span style="color:white">Perspectives</span></a></font></center></th>
    <th bgcolor="#be1e3c"><center><font size="+1"><a href="Sponsoren"><span style="color:white">Sponsoring</span></a></font></center></th>
   </tr>

</table>

   <col width="200px">
   <col width="800px">
   <col width="200px">
 </colgroup>

  <style type="text/css">

body { height:500px; } div { }

f1 { position:fixed; top:450px; left:"200"; width:110px; height:100px; background-color:transparent; }

</style> <body> <div id="f1"><a href="Braunschweig"><img src="http://openwetware.org/images/b/bf/Zur%C3%BCckpfeil.png"

        width="103" height="88" alt="Back"align="left"></a></div>

</body> </td>

<td> DNA Origami Design DNA is not only a polymer which stores genetic information but also provides the opportunity to build complex structures – so called DNA origami. [1] Each of the four different nucleobases only binds a specific other nucleobase; adenine binds to thymine and guanine to cytosine like it was discovered by Watson and Crick. [2] The three-dimensional DNA origami is designed with a software called caDNAno.[3] The DNA origami consists of one long single stranded DNA called scaffold and hundreds of shorter DNA strands called staples. Each staple binds a certain region of the scaffold strand and models the desired shape of the DNA origami (Figure 1). <div align="center"><img src="http://openwetware.org/images/7/76/Schematic_DNAorigami%28figure1%29.PNG" width="" height="" > </div> <div align="center">Figure 1: Schematic DNA origami. </div> Based on this technique, we designed our Nanoscooter: The length of the scaffold usually varies between 7250 and 8634 nucleotides. For the three-dimensional DNA origami structure Nanoscooter a scaffold with 8064 nucleotides was used. It is designed on a honeycomb lattice mimicking a bumper car (figure 2). For more stability scaffold crossovers as well as staple crossovers are inserted. The staples are designed to have a length between 42 and 49 nucleotides. For enhanced folding every staple has a 14 nucleotide seed which is a region without crossovers.[4-5] The entire set of staple sequences and a sketch of the scaffold and staple architecture of the Nanoscooter can be found in the attached file (<a href="CACGTAATTGACGCCAGCTTTGAAT">Nanoscooter</a>). <div align="center"><img src="http://openwetware.org/images/f/f6/2DOrigami%28figure2%29.PNG" width="" height="" > </div> <div align="center">Figure 2: Two-dimensional view of the DNA origami (18 nm high on the left site, 12 nm high on the right site, 10 nm high in the middle, 62 nm total length).</div> The structure of the Nanoscooter is carefully chosen to show the best performance on the mica surface: First of all, the front part of the Nanoscooter is elevated in comparison to the rest of the structure. That way, the vehicle has better chances not to be pinned down due to obstacles or surface roughness. Furthermore, the outer dimensions are chosen in a way to maximize the chance of correct orientation on the surface (bottom down). Moreover, the sides of the Nanoscooter are inclined to prevent an unfavorable orientation. <div align="center"><img src="http://openwetware.org/images/c/c1/3DOrigami%28figure3%29.PNG" width="" height="" > </div> <div align="center">Figure 3: 3D model of the Nanoscooter (front view, only scaffold, 7 nm broad peak of the front part).</div> The software CanDo is used to model the stability of our DNA origami structure (Figure 4).[6] <div align="center"><iframe width="420" height="315" src="//www.youtube.com/embed/iuwScsE8dC0" frameborder="0" allowfullscreen></iframe> </div> <div align="center">Figure 4: Model of the Nanoscooter by CanDo. Blue stands for a high stability and red areas indicate higher fluctuations.</div> The platinum nanoparticles are tethered to the back of the DNA origami by base pairing of complementary DNA strands. At the back of the DNA origami several staples (located on helices 27, 91 and 103) are elongated with 15 adenines, which bind the platinum nanoparticles modified with thiol functionalized oligonucleotides consisting of 15 thymines. The broad backmost part of the structure offers enough space to accommodate several platinum nanoparticles, increasing the catalytic power and therefore propulsion of the Nanoscooter. At the top of the DNA origami a fluorescent bead can be attached by biotin and StreptAvidin interaction. Therefore three staples on top of the DNA origami (helices 72, 74 and 76) are modified with biotins, which can bind to commercially available StreptAvidin-modified fluorescent beads. <hr style="background-color:#be1e3c;"> <table> <tr><td> [1]</td> <td>P. Rothemund: Folding DNA to create nanoscale shapes and patterns, Nature, 2006, 440, 297-302.</td></tr> <tr><td> [2]</td> <td>J. D. Watson, F. H. C. Crick: Molecular structure of nucleic acids, Nature, 1953, 171, 737-738.</td></tr> <tr><td align="center" valign="top"> [3]</td> <td>S. M. Douglas, A. H. Marblestone, S. Teerapittayanon, A. Vazquez, G. M. Church, W. M. Shih: Rapid prototyping of 3D DNA-origami shapes with caDNAno, Nucl. Acids Res., 2009, 37, 5001-5006. </td></tr> <tr><td align="center" valign="top"> [4]</td> <td>Y. Ke, G. Bellot, N. V. Voigt, E. Fradkov, W. M. Shih: Two design strategies for enhancement of multilayer–DNA origami folding: underwinding for specific intercalator rescue and staple-break positioning, Chemical Science, 2012, 3, 2587-2597. </td></tr> <tr><td align="center" valign="top"> [5]</td> <td>T. G. Martin, H. Dietz: Magnesium-free self-assembly of multi-layer DNA objects, Nature communications, 2012, 3, 1103.</td></tr>

<tr><td> [6] </td> <td>CanDo - Computer-aided engineering for DNA origami, http://cando-dna-origami.org/ , final request 25.10.2014. </td></tr></table>

</td> <td> </td>

</tr> </table>

</body>

</html>

Biomod/2014/Design

Navigation menu

Page actions

Page actions

Personal tools

Navigation

Search

research

Tools