BYU iGEM/Notebook/7 February 2011

From OpenWetWare

Jump to: navigation, search

Multiple cloning site addresses

Part Placement within MCS
Part Placement within MCS

Brief idea of how we want to arrange everything in the multiple cloning site.

OxyR and SoxR work

Designed primers to PCR the E. Coli genes.

Playing with thermoswitches on our computer program

Of the sequences listed below, we decided to use Mutation11, GriffShort, GriffMed, GriffLong, and the original listeria sequence. Sequences were picked based on their similarity to the original listeria sequence either in folding conformation or in energy prediction.

Original sequence taken from the listeria paper: UGUAAAAAACAUCAUUUAGCGUGACUUUCUUUCAACAGCUAACAAUUGUUGUUACUGCCUAAUGUUUUUAGGGUAUUUUAAAAAAGGGCGAUAAAAAACGAUUGGGGGAUGAGACAUGAACGCUCAAGCA Energy: -23.5

Mutation1 UGUAAAAAACAUCAUUUAGCGUGACUUUCCAAUUUCAGCUAACAAUUGUUGUUACUGCCUAAUGUUUUUAGGGUAUUUUAAAAAAGGGCGAUAAAAAACGAUUGGGGGAUGAGACAUGAACGCUCAAGCA Energy:-25.4

MutationSD UGUAAAAAACAUCAUUUAGCGUGACUUUCUUUCAACAGCUAACAAUUGUUGUUACUGCCUAAUGUUUUUAGGGUAUUUUAAAAAAGGGCGAUAAAAAACGAUUGGAGGAGGUUGAGACAUGAACGCUCAAGCA Energy:-31.8

MutationSD2: UGUAAAAAACAUCAUUUAGCGUGACUUUCUUUCAACAGGGAACAAUUGUUGUUACUGCCUAAUGUUUUUAGGGUAUUUUAAAAAAGGGCGAUAAAAAACGAUUGGAGGAGGUUGAGACAUGAACGCUCAAGCA Energy:-27.9

Mutation GriffLong: Cut 14nt from 5' and ant from 3'; Changed SD to GGAGG from GGGGG. UUUAGCGUGACUUUCUUUCAACAGCUAACAAUUGUUGUUACUGCCUAAUGUUUUUAGGGUAUUUUAAAAAAGGGCGAUAAAAAACGAUUGGAGGAUGAGACAUGAACGCUCAA Energy:-24.1

Mutation GriffLong+: Added the correct 2 bases back onto the GriffLong. CAUUUAGCGUGACUUUCUUUCAACAGCUAACAAUUGUUGUUACUGCCUAAUGUUUUUAGGGUAUUUUAAAAAAGGGCGAUAAAAAACGAUUGGAGGAUGAGACAUGAACGCUCAAGC Energy:-24.1

Mutation GriffMed: Cut a sequence to shorten the loops. UUUAGCGUGACUUUCUUUCAACAGCUAACAAUUGUUGUUACUGCCUAAUGUAAGGGCGAUAAAAAACGAUUGGAGGAUGAGACAUGAACGCUCAA Energy:-22.9

Mutation GriffShort: Cut another sequence to shorten. UUUAGCGUGACUUUCUUUCAACAGCUAACAAUUGUUGUAAAAACGAUUGGAGGAUGAGACAUGAACGCUCAA Energy:-16.3

Mutation GriffShort2: Changed some bases to increase pairing. UUUAGCGUUCCUUUCUUUCAACAGCUAACAAUUGUUGUAAAAACGAUUGGAGGAUGAGACAUGAACGCUCAA Energy:-19.8

Mutation9: Continued base changes to increase pairing. UUUAGCGUUCCUUUCUUUCAACAGCUAACAAUUGUUGUAAAAACGAUUGGAGGAUGAGACAUGAACGCUCAA Energy:-17.7

Mutation10: UUUAGCGCUCCUUUCUUUCAACAGCUAACAAUUGUUGUAAAAACGAUUGGAGGAUGAGACAUGAGCGCUCAA Energy:-22.2

Mutation11: UUUGGCGCUCCUUUCUUUCAACAGCUAACAAUUGUUGUAAAAACGAUUGGAGGAUGAGACAUGAGCGCCCAA Energy:-24.2



Previous Next
Personal tools