OUR TEAM
Candice Chen: Experimental Protocol Planner
| Brent Hayes Russon: Research and Development Specialist
| Abdulaziz Alamal: Open PCR Machine Engineer
| Andrew Munoz: Experimental Protocol Planner
| Abdullah Alqahtani: Open PCR Machine Engineer
|
LAB 1 WRITE-UP
Initial Machine Testing
The Original Design
The device above is a machine used for performing polymerase chain reactions (PCR). PCR is a process used to make copies of a particular DNA sequence in large enough quantities to be studied or analyzed. The machine has an internal oven for heating and cooling DNA samples and connects to your computer through a USB cable so you can program it.
Experimenting with the Connections
Part 3 is called the heat sink while Part 6 is called the brain board. When you unplug the heat sink from the brain board, the LCD screen ends up turning off.
Part 2 is the temperature sensor, so when you unplug it from the brain board, the machine can no longer read any temperatures.
Test Run
We tested Machine #9 on 10/25/12 with a simple test run program to ensure that it was functioning properly. The program involved heating the machine to 95°C for 30 seconds initially, then running two cycles of 95°C for 30 seconds, 55°C for 30 seconds, and 72°C for one minute with a final hold temperature of 20°C. When it finished, the temperature displayed on the machine's LCD screen matched the number on the computer, meaning it was working correctly.
Protocols
Polymerase Chain Reaction
PCR is used to generate copies of a specific sequence of DNA in massive quantities. This is done by exposing the DNA to heat in order to denature it into two strands, then cooling it so that primers can bind to either end of the target sequence. The primers restrict the area that can be replicated to only the desired sequence. Next, heat-resistant Taq DNA polymerase (usually taken from bacteria) copies in complementary strands for both template strands, doubling the amount of DNA. This process of denaturing and replicating is repeated over and over until the desired amount of DNA is generated.
Steps to PCR
- Put the extracted DNA in a PCR tube.
- Add the forward and reverse primers to the tube.
- Add the master mix to the tube.
- Place the tube in the PCR machine and start the program. Each cycle of the program involves 3 parts.
- Denaturation: The DNA is first heated to 95°C to denature it.
- Annealing: The DNA is cooled to 57°C to allow the primers to bind to each template strand.
- Elongation: The DNA is heated back up to 72°C to prompt the Taq DNA polymerase to copy in complementary strands.
- The DNA is cycled 30 times before being held at 4°C.
PCR Master Mix Components
- Bacterially-derived Taq DNA polymerase
- dNTPs
- MgCl2
- Forward primer
- Reverse primer
| Reagent | Volume
|
| Template DNA (20 ng) | 0.2 μL
|
| 10 μM forward primer | 1.0 μL
|
| 10 μM reverser primer | 1.0 μL
|
| GoTaq master mix | 50.0 μL
|
| dH2O | 47.8 μL
|
| Total Volume | 100.0 μL
|
PCR Samples
- Positive Control: Cancer DNA template
- Negative Control: No DNA template
- Patient 1 Replicate 1 (ID: 54056, Sex: Female, Age: 62)
- Patient 1 Replicate 2 (ID: 54056, Sex: Female, Age: 62)
- Patient 1 Replicate 3 (ID: 54056, Sex: Female, Age: 62)
- Patient 2 Replicate 1 (ID: 81857, Sex: Female, Age: 63)
- Patient 2 Replicate 2 (ID: 81857, Sex: Female, Age: 63)
- Patient 2 Replicate 3 (ID: 81857, Sex: Female, Age: 63)
Flourimeter Assembly
- Put the slide into the fluorimeter with the glass side facing down.
- Using the pipette marked with the blue stripe, place one droplet of SYBR Green I in the middle well of the first row and one droplet of SYBR Green I in the middle well of the second row. The two droplets should combine into one big drop.
- Using a separate clean pipette, add two droplets of the sample being tested to the SYBR Green I drop.
- Adjust the slide as needed so the drop is aligned with the fluorimeter's light. The light should shine through the middle of the drop when you turn it on.
- Adjust your smartphone camera's settings as follows: turn off the flash, set the ISO to ≥800, set the white balance to auto, set exposure and saturation to their highest settings, and set contrast to the lowest setting.
- Stand the smartphone upright in the cradle and set the cradle a few inches in front of the fluorimeter at a right angle to the slide.
- Place the light box over the entire setup and turn on the fluorimeter's light.
- If the smartphone has a timer setting, set it and shut the light box so photos of the drop can be taken in complete darkness. Otherwise, keep the flap lowered as much as possible while you manually take photos.
- Clean off the first drop and repeat steps 2-3 using the next two rows of wells and the next sample to be tested. Up to 5 samples can be tested per slide. Obtain a new slide when all rows of wells have been used.
Image J
- Transfer the photos from your smartphone to your computer and open the desired photo in Image J.
- In the menu, navigate to Analyze>Set Measurements and select Area Integrated Density and Mean Gray Value.
- Then, navigate to Image>Color>Split Channels. This splits the image into Red, Blue, and Green files. Choose the Green one.
- Activate the oval selection tool and use it to draw an oval around the drop.
- Navigate to Analyze>Measure and write down the sample numbers and measurement values.
- To get a reading of the background noise, draw another oval of the same size above the drop in the Green image and navigate to Analyze>Measure. Write down the sample numbers and measurement values, and be sure to distinguish them from the original drop measurements.
Research and Development
Specific Cancer Marker Detection - The Underlying Technology
The r17879961 sequence has a possible nucleotide alteration associated with cancer. When there is a replacement of a T nucleotide with a C nucleotide, a higher risk of cancer is known to occur. This variance is found in the bottom strand of DNA, so the bottom strand is considered the template DNA. (Note that this is the bottom strand that does have the cancer-associated C nucleotide). A DNA primer is developed that is 20 letters long. A DNA primer is essentially a synthetic copy of the DNA sequence. Another primer is made for the corresponding top strand 200 letters down the DNA sequence. For this specific cancer-associated sequence, the bottom primer is [AACTCTTACACTGCATACAT] (the genetic variant "C" is bolded) and the top primer is [TAGTGACAGTGCAATTTCAG]. These primers will attach to the other half of the DNA, but only if there is a matching genetic code for them to attach to. The top primer should always have a matching pair to attach to because there should be no genetic variance in its counterpart while the bottom primer will only match up with its corresponding strand of DNA if the genetic variance is present. A Taq DNA polymerase then connects to any attached primers, which along with MgCl2, makes it possible for free-floating nucleotides to fill in the rest of the letters missing from the DNA strand. This process is then repeated numerous times. If the mutation is not present then only the top primer will find a match and the reproduction of DNA will not show a noticeable increase. If the mutation is present in the subject's DNA then both primers will find matching pairs and create two full new sets of this sequence. As the process is repeated the amount of the sequences present will increase exponentially.
Baye's Rule
The data can be further understood by applying Baye's Rule. Utilizing Baye's Rule lets you understand many different statistics about the data.
Let:
P(C)= Probability of having the C genetic variance in the r17879961 sequence
P(nC)= Probability of not having the C genetic variance
P(hc)= Probability of having cancer
P(nc)= Probability of not having cancer
P(C|hc)= Probability of having the C genetic variance if you have cancer
P(hc|C)= Probability of having cancer if you have the C genetic variance
P(C|nc)= Probability of having the C genetic variance if you don't have cancer
P(nc|C)= Probability of having not having cancer and having the C genetic variance
P(nC/hc)= Probability of not having the C genetic variance if you have cancer
P(hc/nC)= Probability of having cancer if you don't have the C genetic variance
P(nC|nc)= Probability of not having the C genetic variance if you don't have cancer
P(nc|nC)= Probability of not having cancer if you don't have the C genetic variance
Obviously some of these stats are more useful than others. Unfortunately not enough variables are known to solve for all of the probabilities.
P(C)= 5.3%
P(nC)= 100% - P(C)= 94.7%
P(C|hc)= 7.8%
P(nC|hc)= 100% - P(C|hc) = 92.2%
It is clear that all the values are related to each other in some way or another. If one other value was known then the entire set of probabilities could be solved for. Some equations that would be used are:
(((100%-P(hc))x P(C|nc)) + ((P(hc) x P(C|hc)) = P(C)
P(hc) x P(C|hc) x 1/P(C) = P(hc|C)
These values are important because they can show sensitivity, specificity, positive predictive value (PPV), and negative predictive value (NPV). Sensitivity is P(C|hc). Specificity is P(nc|nC). PPV is P(hc|C). NPV is P(C|nc). Even though there are many values that we don't have, the data available still says a lot.







Images courtesy of OpenPCR.
Results
| Sample | Integrated Density | DNA μg/mL | Conclusion
|
| PCR: Water | 1971426 | 1.21967 | Negative
|
| PCR: Calf Thymus | 4621837 | 2.85942 | Positive
|
| PCR: Negative Control | 1665401 | 1.03034 | Negative
|
| PCR: Positive Control | 3232708 | 2 | Positive
|
| PCR: Patient 1 ID 54056, rep 1 | 2023462 | 1.25187 | Negative
|
| PCR: Patient 1 ID 54056, rep 2 | 2114536 | 1.30821 | Negative
|
| PCR: Patient 1 ID 54056, rep 3 | 5292340 | 3.27425 | Positive
|
| PCR: Patient 2 ID 81857, rep 1 | 1528152 | 0.94543 | Negative
|
| PCR: Patient 2 ID 81857, rep 2 | 2197838 | 1.35975 | Negative
|
| PCR: Patient 2 ID 81857, rep 3 | 2238068 | 1.38464 | Negative
|
KEY
- Sample = Each sample contained two drops of SYBR GREEN I and two drops of whichever substance was being tested.
- Integrated Density = The integrated density was calculated by subtracting the integrated density of the background from the integrated density of the drop. This accounts for the background "noise" in each image.
- DNA μg/mL = The DNA μg/mL value was calculated by dividing each sample's integrated density by the integrated density of the positive control sample and then multiplying that by 2.
- Conclusion = A positive reading means the cancerous DNA mutation is present in the sample, indicated by having ≥2 μg/mL since the positive control contained 2 μg/mL. A negative reading means the cancerous DNA mutation is not present, indicated by having less than 2 μg/mL.
|