BME100 s2014:W Group13 L6

BME 100 Spring 2014	Home People Lab Write-Up 1 | Lab Write-Up 2 | Lab Write-Up 3 Lab Write-Up 4 | Lab Write-Up 5 | Lab Write-Up 6 Course Logistics For Instructors Photos Wiki Editing Help
OUR TEAM Name: Nicole Phillips Role: Leader, Experimental Protocol Professional Name: Francis Taguinod Role:Research and Development Adept Name: Christian "Chin-Chin" Kaiser Role: PCR Machine Specialist Name: Augusta Dumanski Role: Team Mascot, Experimental Technician Name: Christiana Montoi-Reeves Role: Research and Development Guru LAB 6 WRITE-UP Computer-Aided Design TinkerCAD TinkerCAD is a 3D modeling program that can be used to build a visual prototype of an object. To build our prototype, we simply imported and organized the pieces of the openPCR machine and added our changes visually by including strategically placed shapes within the design. Our Design Our design has a laser sensor in the lid to tell when the lid is in the correct position. Background: The single nucleotide polymorphism rs237025 is found in the human chromosome 6:149721690. A sequence of alleles is changed from 'GTG' to 'ATG'. This variation occurs in the gene SUM04. This gene is responsible for encoding ubiquitin-related modifiers. This change can cause rhuemetoid arthritis or type 1 diabetes. Disease SNP-specific Forward Primer: 5'TGAACCACGGGGATTGTCAA Reverse Primer: 5'CGTAAGAGTTAATCTTGTGA How the primers work: The forward primer is disease sequence specific. It contains twenty bases, ending with the first nucleotide from the disease-associated allele. Because the primer ends with the disease nucleotide 'A' rather than the non-diseased 'G', only DNA sequences with the disease will be able to replicate. The reverse primer is not disease specific. It is also twenty bases long and ends 200 bases after the forward primer. Feature 2: Consumables Kit Packaging: For the consumables kit to be packaged, we would place them inside the kit in an orderly fashion that would allow easy identification of the certain parts of the flourimeter, PCR machine and other materials required from this lab. Each would be in a seperate pile of its own deisgn, flourimeter materials would be placed in a perfectly safe contained environment that would allow the glass materials to be less vulnerable from the shaking of the box. Changes: The consumables package will be changed according to our design to allow a more easier access utilizing our consumables. Even though the wood be considered a cheap and abundance of resource we will include a sturdier use of the wood. The tubes can be pre-labeled to avoid causing confusion when used in group projects in which members would cause similar names. Also certain dangerous glass materials can be replaced using a less fragile source like composite glass that would prevent the dangers of breaking the glass and yet allowing the light to be visible in experiments. Feature 3: Hardware - PCR Machine & Fluorimeter The PCR machine and flourimeter will stay seperate in order to keep the integrity of the process in tact. They will be packaged in seperate boxes with bubble wrap. The PCR machine will be in seperate pieces so that it can be packaged in a smaller box. The flourimeter will come with extra LEDs and black tape in order to fix any hoels in the cover. To make the PCR machine more productive, we added a laser sensor to the lid in order to keep the lid from being pushed down too far and harming the contents. This reduces waste due to human error. Also, the forward primer is disease sequence specific. It contains twenty bases, ending with the first nucleotide from the disease-associated allele. Because the primer ends with the disease nucleotide 'A' rather than the non-diseased 'G', only DNA sequences with the disease will be able to replicate. The reverse primer is not disease specific. It is also twenty bases long and ends 200 bases after the forward primer. The flourimeter needs basic tweeks as well, including a better dark cover and a stronger LED. The actual machine though, is going to be kept the same because it is very durable and effective, just not perfect. Bonus Opportunity: What Bayesian Stats Imply About The BME100 Diagnostic Approach [Instructions: This section is OPTIONAL, and will get bonus points if answered thoroughly and correctly. Here is a chance to flex some intellectual muscle. In your own words, discuss what the results for calculations 3 and 4 imply about the reliability of PCR for predicting the disease. Please do NOT type the actual numerical values here. Just refer to them as being "close to one" or "very small." The instructors will ask you to submit your actual calculations via a Blackboard quiz. We are doing so for the sake of academic integrity and to curb any temptation to cheat.]