AU Biomaterials Design Lab:Materials/ADA Gene

From OpenWetWare

Jump to: navigation, search

Gene Sequence

The Adenosine Deaminase Sequence from addGene, Plasmid 25576: Py-ADA

GAAATAAAGTTCCTCAAAAAGGAAGATGTACAAAACATCGATTTAAACGGAATGAGTAAAAAAGAAAGAT ATGAAATATGGAGAAGAATTCCCAAAGTTGAATTACATTGCCATTTAGATTTAACATTTTCTGCTGAATT TTTTTTAAAATGGGCTCGAAAATATAATCTACAACCTAACATGTCAGATGACGAAATACTTGATCATTAT TTATTTACAAAAGAAGGAAAATCATTAGCAGAATTTATTAGAAAAGCAATAAGTGTTTCTGATTTATATA GAGATTATGATTTTATTGAAGATTTGGCCAAATGGGCAGTTATTGAAAAATATAAAGAAGGTGTTGTTTT AATGGAATTTCGATATTCACCAACTTTTGTTTCTTCATCTTATGGATTAGATGTAGAATTGATTCATAAA GCATTTATAAAAGGAATAAAAAATGCTACAGAATTATTAAACAATAAAATACATGTTGCATTAATATGTA TTAGTGATACTGGACATGCTGCTGCTAGTATTAAACATTCTGGAGATTTTGCAATTAAACATAAACATGA TTTCGTTGGTTTTGATCATGGTGGACGTGAAATAGATTTAAAAGATCATAAAGATGTATATCATTCAGTT AGGGATCATGGTTTACATCTAACTGTACATGCAGGTGAAGATGCAACTTTACCAAATCTAAATACTTTAT ATACTGCTATCAATATTTTAAATGTTGAACGTATTGGTCATGGTATAAGAGTTTCAGAATCAGATGAACT AATTGAATTAGTTAAAAAAAAAGATATCTTATTAGAAGTATGCCCAATATCTAATCTTTTATTAAATAAT GTTAAATCTATGGATACACATCCAATTAGAAAATTATATGATGCTGGTGTTAAAGTATCTGTTAATTCCG ATGATCCTGGAATGTTTTTATCAAACATAAATGATAATTACGAAAAATTATATATCCATCTAAATTTTAC ATTAGAAGAATTTATGATTATGAATAACTGGGCTTTTGAAAAATCTTTCGTTAGTGACGATGTTAAAAGC GAGCTTAAAGCGTTGTACTTT

Personal tools