User:Saroj Pandey/Notebook/SNP PCR optimization/2014/11/14: Difference between revisions
Saroj Pandey (talk | contribs) |
(fix raw html notebook nav) |
||
(One intermediate revision by one other user not shown) | |||
Line 2: | Line 2: | ||
|- | |- | ||
|style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> Project name</span> | |style="background-color: #EEE"|[[Image:owwnotebook_icon.png|128px]]<span style="font-size:22px;"> Project name</span> | ||
|style="background-color: #F2F2F2" align="center"| | |style="background-color: #F2F2F2" align="center"|[[File:Report.png|frameless|link={{#sub:{{FULLPAGENAME}}|0|-11}}]][[{{#sub:{{FULLPAGENAME}}|0|-11}}|Main project page]]<br />{{#if:{{#lnpreventry:{{FULLPAGENAME}}}}|[[File:Resultset_previous.png|frameless|link={{#lnpreventry:{{FULLPAGENAME}}}}]][[{{#lnpreventry:{{FULLPAGENAME}}}}{{!}}Previous entry]] }}{{#if:{{#lnnextentry:{{FULLPAGENAME}}}}|[[{{#lnnextentry:{{FULLPAGENAME}}}}{{!}}Next entry]][[File:Resultset_next.png|frameless|link={{#lnnextentry:{{FULLPAGENAME}}}}]]}} | ||
|- | |- | ||
| colspan="2"| | | colspan="2"| | ||
Line 66: | Line 66: | ||
• There were also a few unspecific bands with taster DNA at lower temperatures. | • There were also a few unspecific bands with taster DNA at lower temperatures. | ||
• The most prominent bands for both the taster and the non-taster DNA samples were observed at | • The most prominent bands for both the taster and the non-taster DNA samples were observed at 58.2°C and 61.5°C. | ||
'''Conclusion''' | '''Conclusion''' | ||
• | • Optimal temperature for a PCR to separate the taster and non-taster alleles lies between 58.2°C and 61.5°C. | ||
Latest revision as of 00:32, 27 September 2017
Project name | Main project page Previous entry |
Final separation and gradient PCRPTC taster and non-taster separation Two primer pairs were taken so that the PTC taster and non-taster could be separated.
EP9_F: AGCTATGCCCCCTTTCCTCT Cfb(R): CAATCACTGTTGCTCAGTGG Product size: 911bp
ga_F: ATCCGTGATGCTGTGCTATG Gfb(R): CAATCACTGTTGCTCAGTGC Product size: 510bp
• Taster: Taster specific primer pair produced a 911bp band while there were no specific bands with non-taster specific primer pair. • Non-taster: Non-taster specific primer pair produced a 510bp band while there were no specific bands with taster specific primer pair. • Blanks: Water sample used instead of the genomic DNA produced only unspecific products, primer dimers probably, with both sets of primers.
• PTC taster and non-taster can be identified genotypically with PCR using the primer pairs used in this experiment.
Gradient PCR using the specific primer pairs was performed to identify optimal temperature for both taster and non-taster.
• All the temperatures applied in this PCR were able to produce specific bands for both taster and non-taster. • There were also a few unspecific bands with taster DNA at lower temperatures. • The most prominent bands for both the taster and the non-taster DNA samples were observed at 58.2°C and 61.5°C.
• Optimal temperature for a PCR to separate the taster and non-taster alleles lies between 58.2°C and 61.5°C.
|