User:Saroj Pandey/Notebook/SNP PCR optimization/2014/11/13

From OpenWetWare

Jump to: navigation, search
Project name Main project page
Previous entry      Next entry

Allele Specific PCR

Four different forward primers were used in combination with the two specific reverse primers for taster and non-taster.

saliva PCR
saliva PCR
electrophoresis
electrophoresis


Forward primers used:

EP9_F: AGCTATGCCCCCTTTCCTCT

EP7_F: TGGAAAGGAACCATGCATTT

GaF  : ATCCGTGATGCTGTGCTATG

EP3_F: CCCTCTAAGTTTCCTGCCAGA


Reverse primers used:

Cfb(R): CAATCACTGTTGCTCAGTGG

Gfb(R): CAATCACTGTTGCTCAGTGC


Expected product sizes:

911bp, 760bp, 510bp, 356bp


Observation

• For taster, first three combinations of the primers gave bands at specific positions but the EP_3+Cfb(R) did not give specific band. This is because the enzyme was not added to the mixture during the PCR. So the amount of unspecific product is much higher.

• All the primer combinations worked and showed specific bands at correct positions for non-taster.

• Unspecific primers did not produce bands as with the specific ones. So the separation was successful.


Conclusion

• With these primer combinations, the taster and non-taster of the phenylthiocarbamide (PTC) can be identified genotypically.




Personal tools