Sex genotyping of mice

From OpenWetWare

Revision as of 08:24, 6 April 2011 by Jakob Suckale (Talk | contribs)
Jump to: navigation, search

While adult mice can be readily sexed using anatomical features, young male and female mouse embryos are not yet sufficiently developed to assess their sex. In fact, their genital tubercles look superficially identical. At E16, only about 4 days before birth, the tubercle looks like this: E16 genital tubercles in Baskin's book, p. 108, figure 2.

If the sex cannot be determined by inspection, a genotyping PCR for any region only found on the Y chromosome [1] can be used.

Common male-specific PCRs

Sry Sex-determining region of the Y chromosome [2]

  • forward SRY F : TTG TCT AGA GAG CAT GGA GGG CCA TGT CAA
  • reverse SRY R : CCA CTC CTC TGT GAC ACT TTA GCC CTC CGA
  • PCR product: 273 base pair PCR product
Uni Washington, St. Louis, Mouse Genetics Core
  • forward sry1 AACAACTGGGCTTTGCACATTG
  • reverse sry2 GTTTATCAGGGTTTCTCTCTAGC
  • PCR product: 166, 146 bp doublet
MMRRC's genotyping protocol including Sry primers


Homologous pair SmcX/SmcY

  • SMCX-1 5'CCGCTGCCAAATTCTTTGG3'
  • SMC4-1 5'TGAAGCTTTTGGCTTTGAG3'
  • PCR product: females single band, males 2 bands because of an intron difference between the X and Y genes (Agulnik 1997, PMID 9060413); source: [3]
X chromosomal SmcX = Kdm5c [4]
Y chromosomal SmcY = Kdm5d [5]
Personal tools