SBB10Ntbk-ZhenZongHuang: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
No edit summary |
No edit summary |
||
Line 20: | Line 20: | ||
===sbb15=== | ===sbb15=== | ||
I made The oligo concentrations of 100uM for ZHH003 and ZHH004 by adding the right amount of DDH20 | |||
I added the following into a PCR tube in the following order: | I added the following into a PCR tube in the following order: | ||
#29 uL water | #29 uL water | ||
Line 27: | Line 30: | ||
#5 uL Oligo 2 (100uM) | #5 uL Oligo 2 (100uM) | ||
#0.75 uL Expand Polymerase 1 | #0.75 uL Expand Polymerase 1 | ||
I put the resulting wobble PCR tube in the 2k55 ice bucket. | I put the resulting wobble PCR tube in the 2k55 ice bucket. | ||
==[[User:Zhen Zong Huang|Zhen Z. Huang]] 15:05, 16 February 2010 (EST)== | ==[[User:Zhen Zong Huang|Zhen Z. Huang]] 15:05, 16 February 2010 (EST)== |
Revision as of 23:57, 18 February 2010
Zhen Z. Huang 16:05, 17 February 2010 (EST)
Wed, Feb 17th, 2010
I prepared a PCR reaction for sbb31 and a wobble reaction for sbb15.
sbb31
I made The oligo concentrations of 100uM for ZHH001 and ZHH002 by adding the right amount of DDH20. Then I made oligo dilution of with 9uL Water and 1uL 100uM of the oligos to make 10uM.
I added the following into a PCR tube in the following order:
- 24uL ddH2O
- 3.3uL 10x Expand Buffer "2"
- 3.3uL dNTPs (2mM in each)
- 1uL Oligo 1, 10uM
- 1uL Oligo 2, 10uM
- 0.5uL Expand polymerase "1"
- 0.5uL Template DNA
I put the the PCR tube in the 2K55 ice bucket.
sbb15
I made The oligo concentrations of 100uM for ZHH003 and ZHH004 by adding the right amount of DDH20
I added the following into a PCR tube in the following order:
- 29 uL water
- 5 uL Expand 10x Buffer 2
- 5 uL 10x dNTPs (2 mM in each; 0.2 mM final conc)
- 5 uL Oligo 1 (100uM)
- 5 uL Oligo 2 (100uM)
- 0.75 uL Expand Polymerase 1
I put the resulting wobble PCR tube in the 2k55 ice bucket.
Zhen Z. Huang 15:05, 16 February 2010 (EST)
Planning for Wed, Feb 17th, 2010
sbb31
- PCR
- Analytical gel
- Regular Zymol Clean up
- EcoR1/BamH1 Digest of PCR Product
- Zymol Gel Purification
- Ligation of EcoR1/BamH1 Digest
- Mapping
- Zymol Gel Purification
sbb15
- Wobble
- Small Zymol Clean up
- EcoR1/BamH1 Digest of Wobble Product
- Zymol Gel Purification
- Ligation of EcoR1/BamH1 Digest
- Mapping
- Zymol Gel Purification
Zhen Z. Huang 13:00, 18 February 2010 (EST)
Construction Files for my parts
sbb31
sbb31: CA42 origin of replication Source: pEC22-CA42 Target Sequence: agcacttcagcgcgccgtagcatcgataaacattacgggatggggcgaaactgccatctgttcgaaatgacgcgcaaatgggcttacagggcgattcgtcagggctggccagcattctcacagtggcttgatgccgtgattcagcgtgtcgaaatgtacaacgcatcgcttcccgttccgctttcacctcctgaatgtcgggctattggcaagagtattgcgaaatacacgcacaggaacttcacggcggaaactttcgcacagtatgtggctgatacgcacacgccagaaatacaggccaagagaggcaggaaaggtggcatcgctaaaggcgaagcctacgatgacaagcgtttcatggcgctatgtatgctggagaatggatattctcagaaagctattgcggcgatgttggaggtttctactcgaaccattcgaaactggaaaagcggaaaatagcctatatcagataacagcgcctttctggcgtttttttgagcagtaggtcttttgccg Vector: pBjk2741 Short description: oriCA42 Genbank reference: D30056.1 Family: Origin of Replication PCR ZZH001 and ZZH002 on pEC22-CA42 (547 bp, EcoRI/BamHI) Sub into pBjk2741-Bca1144 (EcoRI/BamHI, 2472+910, L) Product is pBca9523-sbb31 {oriCA42} ---------------------------- ZZH001 Forward oligo for cloning of oriCA42 ccataGAATTCatgAGATCTagcacttcagcgcgccgtag ZZh002 Reverse oligo for cloning of oriCA42 ctgatGGATCCcggcaaaagacctactgctc
sbb15
sbb15: phiC31 attB Source: Synthetic Target Sequence: tgacggtctcgaagccgcggtgcgggtgccagggcgtgcccttgggctccccgggcgcgtactccacctcacccatctggtcca Vector: pBjk2741 Short descriptions: phiC31 attB Genbank reference: AB306970 (759…842) Family: Phage att site good 20 bp gtgccagggcgtgcccttgg Wobble ZZH003/ZZH004 (115bp, EcoRI/BamHI) Sub into pBjk2741-Bca1144 (EcoRI/BamHI, 2170+910, L) Product is pBjk2741-sbb15 {phiC31 attB} ---- ZZH003 Forward construction of phiC31 attB basic part ccataGAATTCatgAGATCTtgacggtctcgaagccgcggtgcgggtgccagggcgtgcccttgg ZZH004 Reverse construction of phiC31 attB basic part ctgatGGATCCtggaccagatgggtgaggtggagtacgcgcccggggagcccaagggcacgccctggcac