User contributions
From OpenWetWare
(Latest | Earliest) View (newer 50) (older 50) (20 | 50 | 100 | 250 | 500)
- 18:08, 12 April 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang (→Zhen Z. Huang 15:00, 12 April 2010 (EST)) (top)
- 18:00, 12 April 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 18:05, 7 April 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 18:04, 7 April 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 18:02, 7 April 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 17:55, 7 April 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 17:54, 7 April 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 17:52, 7 April 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 17:27, 31 March 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 17:20, 31 March 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 17:12, 31 March 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 16:30, 31 March 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 16:27, 31 March 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 16:26, 31 March 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 16:19, 31 March 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 23:15, 10 March 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 21:45, 10 March 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 19:45, 1 March 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 19:12, 1 March 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 19:33, 24 February 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 19:32, 24 February 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 19:00, 24 February 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 18:05, 24 February 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 17:16, 24 February 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 19:31, 22 February 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 19:16, 22 February 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 19:14, 22 February 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 19:14, 22 February 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 18:50, 22 February 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 18:49, 22 February 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 17:36, 22 February 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 02:57, 19 February 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 02:57, 19 February 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 02:56, 19 February 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 20:17, 17 February 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 18:40, 17 February 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 17:08, 17 February 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 22:14, 16 February 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 21:56, 16 February 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 19:13, 16 February 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 19:11, 16 February 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 19:53, 10 February 2010 (hist) (diff) Template:SBB10Indiv-41163 (top)
- 19:51, 10 February 2010 (hist) (diff) Image:Zhen.jpg (uploaded a new version of "Image:Zhen.jpg") (top)
- 19:44, 10 February 2010 (hist) (diff) N Template:SBB10Indiv-41163 (New page: Image:zhen.jpg)
- 19:42, 10 February 2010 (hist) (diff) N Image:Zhen.jpg (I am a 4th year BioE student.)
- 03:25, 10 February 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 03:24, 10 February 2010 (hist) (diff) SBB10Ntbk-ZhenZongHuang
- 03:23, 10 February 2010 (hist) (diff) N SBB10Ntbk-ZhenZongHuang (New page: ==Construction Files for my parts== ===sbb31=== sbb31: CA42 origin of replication Source: pEC22-CA42 Target Sequence: agcacttcagcgcgccgtagcatcgataaacattacgggatggggcgaaactgccatctgttcgaaat...)
- 03:19, 10 February 2010 (hist) (diff) N Template:SBB10 ConstructionFiles ZhenH sbb15 (New page: <pre> sbb15: phiC31 attB Source: Synthetic Target Sequence: tgacggtctcgaagccgcggtgcgggtgccagggcgtgcccttgggctccccgggcgcgtactccacctcacccatctggtcca Vector: pBjk2741 Short descriptions: phi...)
- 03:18, 10 February 2010 (hist) (diff) N Template:SBB10 ConstructionFiles ZhenH sbb31 (New page: <pre> sbb31: CA42 origin of replication Source: pEC22-CA42 Target Sequence: agcacttcagcgcgccgtagcatcgataaacattacgggatggggcgaaactgccatctgttcgaaatgacgcgcaaatgggcttacagggcgattcgtcagggctggcc...)
(Latest | Earliest) View (newer 50) (older 50) (20 | 50 | 100 | 250 | 500)
