SBB10Ntbk-DanielSedor: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
 
(15 intermediate revisions by the same user not shown)
Line 4: Line 4:
<br>
<br>
<br>
<br>
=='''Construction Files'''==
==Construction Files==
=== sbb10: Sleeping beauty (SB100x) ===
=== sbb10: Sleeping beauty (SB100x)===


<br>
<br>
Line 38: Line 38:
<br>
<br>


=== sbb39: Magnesium-repressed Promoter ===
===sbb39: Magnesium-repressed Promoter===
<br>
<br>
<pre>
<pre>
Line 47: Line 47:
<br>
<br>


=== sbb40: Nuclear localization peptide ===
===sbb10: Nuclear Localization Peptide===
<br>
<pre>
<pre>
Eco/Bam transfer pBjh1601CK-Bjh1858
Eco/Bam transfer pBjh1601CK-Bjh1858
Line 54: Line 53:
Product is pBjk2741-Bjh1858  {<NIS!}
Product is pBjk2741-Bjh1858  {<NIS!}
</pre>
</pre>
<br>


=='''Lab Notes'''==
 
==Lab Notes==
<br>
<br>
===17 February 2010===
===17 February 2010===
2 PCR's according to the [[Template:SBB-Protocols_PCR3 | Cloning by PCR]] protocol using oligos DS001/CA1600 (gp=A) and DS002/CA1597 (gp=B) from the sbb10 construction file.
Prepared two PCR's according to the [[Template:SBB-Protocols_PCR3 | Cloning by PCR]] protocol using oligos DS001/CA1600 (gp=A) and DS002/CA1597 (gp=B) from the sbb10 construction file.
 
Submitted preparation for thermocycling.
 


===22 February 2010===
===22 February 2010===
Mixed 6μL of PCR products sbb10A and sbb10B (2/22 versions) with 4μL of Loading Buffer for the purposes of running a preparative gel (see [[Template:SBB-Protocols_PCR3 | SOEing by PCR]] protocol for more details).
Mixed 6μL of PCR products sbb10A and sbb10B (2/17 versions) with 4μL of Loading Buffer for the purposes of running a preparative gel (see [[Template:SBB-Protocols_PCR3 | SOEing by PCR]] protocol for more details). Preparative  gel results (which can be found [[SBB10_gels#Amy | here]]) did not agree with the predictions made in the construction file.


Prepared two new PCR's according to the [[Template:SBB-Protocols_PCR2 | Cloning by PCR]] protocol.
Prepared two new PCR's according to the [[Template:SBB-Protocols_PCR2 | Cloning by PCR]] protocol.


===24 February 2010===
===24 February 2010===
Mixed 6μL of PCR products sbb10A and sbb10B (2/22 versions) with 4μL of Loading Buffer for the purposes of running a preparative gel (see [[Template:SBB-Protocols_PCR3 | SOEing by PCR]] protocol for more details).
Mixed 6μL of PCR products sbb10A and sbb10B (2/22 versions) with 4μL of Loading Buffer for the purposes of running a preparative gel (see [[Template:SBB-Protocols_PCR3 | SOEing by PCR]] protocol for more details). Preparative gel results (which can be found [[SBB10_gels#JimH | here]]) were in agreement with the predictions made in the sbb10 construction file for the gp=A and gp=B reactions. Performed the [[Template:SBB-Protocols_Zymo3 | Zymo Gel Purification]] protocol on sbb10A and sbb10B in the same zymo column.
 
 
===1 March 2010===
Performed [[Template:SBB-Protocols_PCR3 | SOEing PCR]] protocol using sbb10A+sbb10B as a template and DS001 and DS002 as oligos.
 
 
===8 March 2010===
Purified the DNA from the 3/1 PCR reaction in accordance with the [[Template:SBB-Protocols_Zymo1 | Regular Zymo Cleanup]] protocol.
 
===10 March 2010===
Eco/Bam digest on sbb10. Preparative gel.
Eco/Bam transfer on sbb39.
Eco/Bam transfer on sbb40.

Latest revision as of 15:01, 10 March 2010

Project

Profile


Construction Files

sbb10: Sleeping beauty (SB100x)


Construction of sbb10
PCR DS001/CA1600 on Bca1587 5-1        (420bp, gp=A)
PCR CA1597/DS002 on Bca1587 5-6        (767bp, gp=B)
----------------------------
PCR DS001 and DS002 on A+B   (1051 bp, EcoRI/BamHI)
Sub into pBjk2741            (EcoRI/BamHI, 2170+910, L)
Product is pBjk2741-sb10         {<SB100x!}
----------------------------
DS001   Forward oligo for cloning of <SB100x!  
CCATAgaattcATGagatctGGTAAATCTAAAGAAATCTCTCAGGAC
CA1600	CGAAACGCAGACGAGCTTTTTTGTGACGGTTCTGGAGCAGCGGTTTTTT
PCA assembly of sleepingBeauty (Bca1587)
CA1597	ATGCTGGAAGAAACCGGTACCAAAGTTTCTATCTCTACCGTTAAACGTG
PCA assembly of sleepingBeauty (Bca1587)
DS002   Reverse oligo for cloning of <SB100x!
ctgatGGATCCttaGTATTTGGTAGCGTTACCTT

Part:
gatctGGTAAATCTAAAGAAATCTCTCAGGACCTGCGTAAACGTATCGTTGACCTGCACAAATCTGGTTCTTCTCTGGGTGCTATCTCTAAACGTCTGGCTGTTCCGCGTTCTTCTGTTCAGACCATCGTTCGTAAATACAAACA
CCACGGTACCACCCAGCCGTCTTACCGTTCTGGTCGTCGTCGTGTTCTGTCTCCGCGTGACGAACGTACCCTGGTTCGTAAAGTTCAGATCAACCCGCGTACCACCGCTAAAGACCTGGTTAAAATGCTGGAAGAAACCGGTACC
AAAGTTTCTATCTCTACCGTTAAACGTGTTCTGTACCGTCACAACCTGAAAGGTCACTCTGCTCGTAAAAAACCGCTGCTCCAGAACCGTCACAAAAAAGCTCGTCTGCGTTTCGCTACCGCTCACGGTGACAAAGACCGTACCT
TCTGGCGTAACGTTCTGTGGTCTGACGAAACCAAAATCGAACTGTTCGGTCACAACGACCACCGTTACGTTTGGCGTAAAAAAGGTGAAGCTTGCAAACCGAAAAACACCATCCCGACCGTTAAACACGGTGGTGGTTCTATCAT
GCTGTGGGGTTGCTTCGCTGCTGGTGGTACCGGTGCTCTGCACAAAATCGACGGTATCATGGACGCTGTTCAGTACGTTGACATCCTGAAACAGCACCTGAAAACCTCTGTTCGTAAACTGAAACTGGGTCGTAAATGGGTTTTC
CAGCACGACAACGACCCGAAACACACCTCTAAAGTTGTTGCTAAATGGCTGAAAGACAACAAAGTTAAAGTTCTGGAATGGCCGTCTCAGTCTCCGGACCTGAACCCGATCGAAAACCTGTGGGCTGAACTGAAAAAACGTGTTC
GTGCTCGTCGTCCGACCAACCTGACCCAGCTGCACCAGCTGTGCCAGGAAGAATGGGCTAAAATCCACCCGACCTACTGCGAAAAACTGGTTGAAGGTTACCCGAAACGTCTGACCCAGGTTAAACAGTTCAAAGGTAACGCTAC
CAAATACTAAG


sbb39: Magnesium-repressed Promoter


Eco/Bam transfer pBjh1601CK-Bjh1380
Sub into pBjk2741-Bca1144            (EcoRI/BamHI, 910+2170, L)
Product is pBjk2741-Bjh1380   {PmgtCB}


sbb10: Nuclear Localization Peptide

Eco/Bam transfer pBjh1601CK-Bjh1858
Sub into pBjk2741-Bca1144            (EcoRI/BamHI, 910+2170, L)
Product is pBjk2741-Bjh1858  {<NIS!}


Lab Notes


17 February 2010

Prepared two PCR's according to the Cloning by PCR protocol using oligos DS001/CA1600 (gp=A) and DS002/CA1597 (gp=B) from the sbb10 construction file.

Submitted preparation for thermocycling.


22 February 2010

Mixed 6μL of PCR products sbb10A and sbb10B (2/17 versions) with 4μL of Loading Buffer for the purposes of running a preparative gel (see SOEing by PCR protocol for more details). Preparative gel results (which can be found here) did not agree with the predictions made in the construction file.

Prepared two new PCR's according to the Cloning by PCR protocol.


24 February 2010

Mixed 6μL of PCR products sbb10A and sbb10B (2/22 versions) with 4μL of Loading Buffer for the purposes of running a preparative gel (see SOEing by PCR protocol for more details). Preparative gel results (which can be found here) were in agreement with the predictions made in the sbb10 construction file for the gp=A and gp=B reactions. Performed the Zymo Gel Purification protocol on sbb10A and sbb10B in the same zymo column.


1 March 2010

Performed SOEing PCR protocol using sbb10A+sbb10B as a template and DS001 and DS002 as oligos.


8 March 2010

Purified the DNA from the 3/1 PCR reaction in accordance with the Regular Zymo Cleanup protocol.

10 March 2010

Eco/Bam digest on sbb10. Preparative gel. Eco/Bam transfer on sbb39. Eco/Bam transfer on sbb40.