Registry/Measurement kit/Notebook/2007-6-20: Difference between revisions

From OpenWetWare
Jump to navigationJump to search
No edit summary
No edit summary
Line 14: Line 14:
=="Device B" Primers==
=="Device B" Primers==
*Fwd
*Fwd
**MfeI tail + tccctatcagtgatagagattgacatc
**8-mer + MfeI tail + tccctatcagtgatagagattgacatc
*Rev
*Rev
**NsiI tail + TATAAACGCAGAAAGGCCCAC
**8-mer + NsiI tail + TATAAACGCAGAAAGGCCCAC

Revision as of 13:05, 20 June 2007

To Do

  1. Add new devices into the Registry
  2. Check re-plating of devices A and C (done. no growth.)
  3. Create/order primers for device B
  4. Mini-prep and sequence device B culture (colony 8) and Jason's three cultures (done)

Mini-Prep

  • Spun at 5k for 4.5 min before prepping
  • note: accidentally added 250 of P1 to each tube instead of each culture, but reconsolidated into four miniprep columns. We'll see if this affects the results drastically.
  • Eluted with 30µL of EB.
  • For future reference: when sequencing, should elute with aqueous NaOH solution of pH 8.5
    • Will probably need to re-do this...

"Device B" Primers

  • Fwd
    • 8-mer + MfeI tail + tccctatcagtgatagagattgacatc
  • Rev
    • 8-mer + NsiI tail + TATAAACGCAGAAAGGCCCAC