IGEM:Harvard/2009/Notebook/Harvard iGEM 2010/2010/07/07: Difference between revisions
From OpenWetWare
Jump to navigationJump to search
Alex Gedeon (talk | contribs) No edit summary |
Alex Gedeon (talk | contribs) No edit summary |
||
Line 26: | Line 26: | ||
Cultures were placed in a 37°C incubator and left to shake overnight. | Cultures were placed in a 37°C incubator and left to shake overnight. | ||
===Primers for Wintergreen pathway parts=== | |||
''J45004'' | |||
</br> | |||
Left Primer: 5'cctttctagaatggaagttgttgaagttcttca 3' | |||
Right Primer: 5'aaggctgcagcggccgctactagtttaatttattttggtcaagga 3' (last 5 bp omitted to meet 45 bp maximum) | |||
''J45017'' | |||
Left Primer: 5'cctttctagaatgaaaactcccgaagactgc 3' | |||
Right Primer: 5'aaggctgcagcggccgctactagtttattaggcgacgccgc 3' | |||
Revision as of 11:04, 7 July 2010
iGEM iGarden | <html><img src="/images/9/94/Report.png" border="0" /></html> Main project page <html><img src="/images/c/c3/Resultset_previous.png" border="0" /></html>Previous entry<html> </html>Next entry<html><img src="/images/5/5c/Resultset_next.png" border="0" /></html> |
Team Flavor
SequencingV0120 Plasmids containing the pENTCUP2 plant promoter, NOS terminator and NOS terminator + STOP were sent to GENEWIZ for sequencing. Sequencing results are expected tomorrow.
Cultures5 mL cultures were started from the YFP-2x construct from yesterday, as well as the B15 (StrepII) tag.
Cultures were placed in a 37°C incubator and left to shake overnight.
Primers for Wintergreen pathway partsJ45004
J45017 Left Primer: 5'cctttctagaatgaaaactcccgaagactgc 3' Right Primer: 5'aaggctgcagcggccgctactagtttattaggcgacgccgc 3'
|